Incidental Mutation 'R2883:Nedd1'
ID260926
Institutional Source Beutler Lab
Gene Symbol Nedd1
Ensembl Gene ENSMUSG00000019988
Gene Nameneural precursor cell expressed, developmentally down-regulated gene 1
Synonyms
MMRRC Submission 040471-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.958) question?
Stock #R2883 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location92684746-92722420 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 92694998 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Valine at position 410 (F410V)
Ref Sequence ENSEMBL: ENSMUSP00000020163 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020163]
Predicted Effect probably damaging
Transcript: ENSMUST00000020163
AA Change: F410V

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000020163
Gene: ENSMUSG00000019988
AA Change: F410V

DomainStartEndE-ValueType
WD40 21 63 5.97e-1 SMART
WD40 67 105 9.75e-3 SMART
WD40 108 147 6.19e-5 SMART
WD40 149 191 6.42e-1 SMART
WD40 194 235 9.1e-3 SMART
WD40 238 276 2.24e-2 SMART
low complexity region 555 568 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214417
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001C19Rik C A 17: 47,436,725 V32F probably damaging Het
1700018B08Rik G A 8: 121,539,905 P81S probably damaging Het
Arhgef10l T C 4: 140,516,802 Q790R probably benign Het
Asic2 T A 11: 80,894,013 I367F possibly damaging Het
Asxl2 T C 12: 3,501,830 S1191P probably benign Het
Bod1l A G 5: 41,832,259 S374P probably benign Het
C1qtnf7 T A 5: 43,615,880 F167I probably damaging Het
Col13a1 A G 10: 61,978,356 L94P probably benign Het
Cped1 A T 6: 22,143,979 T575S probably damaging Het
Cpt1b T C 15: 89,417,869 Y702C probably benign Het
D630039A03Rik T A 4: 57,910,560 N84I probably damaging Het
Dse A T 10: 34,152,507 D862E probably benign Het
Etl4 A T 2: 20,806,174 T1023S possibly damaging Het
Fat4 T A 3: 38,980,804 N2868K probably damaging Het
Fgd5 G A 6: 91,987,109 probably null Het
Fsip2 C T 2: 82,991,524 T5867I possibly damaging Het
Fuca2 A G 10: 13,505,951 T203A probably benign Het
Gli2 T C 1: 118,868,144 I131V probably damaging Het
Gtpbp4 A G 13: 8,990,723 V122A possibly damaging Het
Kif1b G A 4: 149,237,648 T938I possibly damaging Het
Klhl29 T C 12: 5,084,036 D767G probably damaging Het
Mageb3 A G 2: 121,954,366 V285A probably benign Het
Myoc A G 1: 162,639,616 E118G possibly damaging Het
Nipal1 A T 5: 72,667,730 K255N probably damaging Het
Npr3 T C 15: 11,883,324 K340E possibly damaging Het
Obsl1 C A 1: 75,496,511 G1023C possibly damaging Het
Ogdh T C 11: 6,334,545 L188P probably damaging Het
Olfr110 C T 17: 37,499,380 S243F probably damaging Het
Olfr1500 T A 19: 13,827,875 I174F probably damaging Het
Olfr616 T C 7: 103,565,264 N5S probably benign Het
Otogl G A 10: 107,768,981 T2188M probably damaging Het
Pck1 G A 2: 173,158,575 V600I probably benign Het
Ranbp17 A G 11: 33,504,708 C42R probably damaging Het
Rapgef4 G A 2: 72,031,125 R53H probably benign Het
Rbm12 G A 2: 156,097,075 H426Y probably damaging Het
Retreg2 C T 1: 75,146,712 P428L probably benign Het
Rev3l G T 10: 39,825,156 S1883I probably damaging Het
Rinl CGGG CGGGGG 7: 28,797,658 probably null Het
Rora T C 9: 69,375,435 S356P probably damaging Het
Slc31a1 T C 4: 62,388,771 V188A probably damaging Het
Slc9a3 A G 13: 74,158,760 K335E probably damaging Het
Spata22 C A 11: 73,344,678 H274N possibly damaging Het
Srrm1 T C 4: 135,321,411 probably benign Het
Stab2 A T 10: 86,967,686 I333N possibly damaging Het
Supt5 A G 7: 28,329,320 Y153H possibly damaging Het
Tyk2 T C 9: 21,110,587 T825A probably benign Het
Usp20 G A 2: 31,018,800 V798M probably benign Het
Wdr26 A T 1: 181,211,120 D102E probably damaging Het
Other mutations in Nedd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00764:Nedd1 APN 10 92694974 splice site probably benign
IGL00988:Nedd1 APN 10 92689686 missense possibly damaging 0.71
IGL01563:Nedd1 APN 10 92698169 critical splice donor site probably null
IGL01588:Nedd1 APN 10 92686262 missense probably benign 0.12
IGL01988:Nedd1 APN 10 92714159 missense probably benign 0.39
IGL02706:Nedd1 APN 10 92686285 missense possibly damaging 0.88
IGL02938:Nedd1 APN 10 92689657 nonsense probably null
IGL03011:Nedd1 APN 10 92689641 missense possibly damaging 0.92
Brainless UTSW 10 92690773 missense probably benign 0.01
R0125:Nedd1 UTSW 10 92691929 missense possibly damaging 0.93
R0173:Nedd1 UTSW 10 92698883 missense probably benign 0.30
R0244:Nedd1 UTSW 10 92716265 intron probably benign
R0645:Nedd1 UTSW 10 92691831 splice site probably null
R0791:Nedd1 UTSW 10 92719614 missense probably damaging 1.00
R1490:Nedd1 UTSW 10 92700798 missense probably damaging 1.00
R1522:Nedd1 UTSW 10 92719614 missense probably damaging 1.00
R1797:Nedd1 UTSW 10 92698739 missense possibly damaging 0.46
R1984:Nedd1 UTSW 10 92714160 missense possibly damaging 0.63
R2474:Nedd1 UTSW 10 92719603 missense probably damaging 0.99
R2877:Nedd1 UTSW 10 92714126 missense possibly damaging 0.89
R4694:Nedd1 UTSW 10 92719582 missense probably benign 0.00
R4798:Nedd1 UTSW 10 92698910 missense probably benign 0.00
R4830:Nedd1 UTSW 10 92686258 missense probably damaging 1.00
R4963:Nedd1 UTSW 10 92695031 missense probably damaging 1.00
R5174:Nedd1 UTSW 10 92711212 missense possibly damaging 0.77
R5329:Nedd1 UTSW 10 92686240 missense probably damaging 1.00
R5404:Nedd1 UTSW 10 92716192 missense probably benign 0.04
R5534:Nedd1 UTSW 10 92695032 missense probably benign 0.01
R6045:Nedd1 UTSW 10 92695100 nonsense probably null
R6154:Nedd1 UTSW 10 92698242 missense possibly damaging 0.65
R6512:Nedd1 UTSW 10 92691875 missense probably benign
R6692:Nedd1 UTSW 10 92698337 missense possibly damaging 0.88
R6693:Nedd1 UTSW 10 92698337 missense possibly damaging 0.88
R6943:Nedd1 UTSW 10 92711306 missense probably damaging 1.00
R7011:Nedd1 UTSW 10 92690773 missense probably benign 0.01
R7406:Nedd1 UTSW 10 92711323 splice site probably null
R7455:Nedd1 UTSW 10 92700925 missense probably benign 0.01
R7587:Nedd1 UTSW 10 92698730 missense probably benign 0.01
R7745:Nedd1 UTSW 10 92714172 missense probably benign
R8104:Nedd1 UTSW 10 92691916 missense probably damaging 1.00
R8209:Nedd1 UTSW 10 92691935 missense probably benign
R8226:Nedd1 UTSW 10 92691935 missense probably benign
Predicted Primers PCR Primer
(F):5'- CGGGGATTGGAACCATGTAC -3'
(R):5'- TAAACTTGCACCAGGGTGG -3'

Sequencing Primer
(F):5'- CCATGTACAGTGACTAGCATTTGC -3'
(R):5'- ACCAGGGTGGGTAATGTCCATTTTAC -3'
Posted On2015-01-23