Mutagenetix > Incidental Mutation

Incidental Mutation 'R2883:Nedd1'

260926

Institutional Source

Beutler Lab

Gene Symbol

Nedd1

Ensembl Gene

ENSMUSG00000019988

Gene Name

neural precursor cell expressed, developmentally down-regulated gene 1

Synonyms

MMRRC Submission

040471-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.963) question?

Stock #

R2883 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

92684746-92722420 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 92694998 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Valine at position 410 (F410V)

Ref Sequence

ENSEMBL: ENSMUSP00000020163 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020163]

AlphaFold

P33215

Predicted Effect

probably damaging
Transcript: ENSMUST00000020163
AA Change: F410V

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000020163
Gene: ENSMUSG00000019988
AA Change: F410V

Domain	Start	End	E-Value	Type
WD40	21	63	5.97e-1	SMART
WD40	67	105	9.75e-3	SMART
WD40	108	147	6.19e-5	SMART
WD40	149	191	6.42e-1	SMART
WD40	194	235	9.1e-3	SMART
WD40	238	276	2.24e-2	SMART
low complexity region	555	568	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000214417

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 94.7%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 48 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700001C19Rik	C	A	17: 47,436,725	V32F	probably damaging	Het
1700018B08Rik	G	A	8: 121,539,905	P81S	probably damaging	Het
Arhgef10l	T	C	4: 140,516,802	Q790R	probably benign	Het
Asic2	T	A	11: 80,894,013	I367F	possibly damaging	Het
Asxl2	T	C	12: 3,501,830	S1191P	probably benign	Het
Bod1l	A	G	5: 41,832,259	S374P	probably benign	Het
C1qtnf7	T	A	5: 43,615,880	F167I	probably damaging	Het
Col13a1	A	G	10: 61,978,356	L94P	probably benign	Het
Cped1	A	T	6: 22,143,979	T575S	probably damaging	Het
Cpt1b	T	C	15: 89,417,869	Y702C	probably benign	Het
D630039A03Rik	T	A	4: 57,910,560	N84I	probably damaging	Het
Dse	A	T	10: 34,152,507	D862E	probably benign	Het
Etl4	A	T	2: 20,806,174	T1023S	possibly damaging	Het
Fat4	T	A	3: 38,980,804	N2868K	probably damaging	Het
Fgd5	G	A	6: 91,987,109		probably null	Het
Fsip2	C	T	2: 82,991,524	T5867I	possibly damaging	Het
Fuca2	A	G	10: 13,505,951	T203A	probably benign	Het
Gli2	T	C	1: 118,868,144	I131V	probably damaging	Het
Gtpbp4	A	G	13: 8,990,723	V122A	possibly damaging	Het
Kif1b	G	A	4: 149,237,648	T938I	possibly damaging	Het
Klhl29	T	C	12: 5,084,036	D767G	probably damaging	Het
Mageb3	A	G	2: 121,954,366	V285A	probably benign	Het
Myoc	A	G	1: 162,639,616	E118G	possibly damaging	Het
Nipal1	A	T	5: 72,667,730	K255N	probably damaging	Het
Npr3	T	C	15: 11,883,324	K340E	possibly damaging	Het
Obsl1	C	A	1: 75,496,511	G1023C	possibly damaging	Het
Ogdh	T	C	11: 6,334,545	L188P	probably damaging	Het
Olfr110	C	T	17: 37,499,380	S243F	probably damaging	Het
Olfr1500	T	A	19: 13,827,875	I174F	probably damaging	Het
Olfr616	T	C	7: 103,565,264	N5S	probably benign	Het
Otogl	G	A	10: 107,768,981	T2188M	probably damaging	Het
Pck1	G	A	2: 173,158,575	V600I	probably benign	Het
Ranbp17	A	G	11: 33,504,708	C42R	probably damaging	Het
Rapgef4	G	A	2: 72,031,125	R53H	probably benign	Het
Rbm12	G	A	2: 156,097,075	H426Y	probably damaging	Het
Retreg2	C	T	1: 75,146,712	P428L	probably benign	Het
Rev3l	G	T	10: 39,825,156	S1883I	probably damaging	Het
Rinl	CGGG	CGGGGG	7: 28,797,658		probably null	Het
Rora	T	C	9: 69,375,435	S356P	probably damaging	Het
Slc31a1	T	C	4: 62,388,771	V188A	probably damaging	Het
Slc9a3	A	G	13: 74,158,760	K335E	probably damaging	Het
Spata22	C	A	11: 73,344,678	H274N	possibly damaging	Het
Srrm1	T	C	4: 135,321,411		probably benign	Het
Stab2	A	T	10: 86,967,686	I333N	possibly damaging	Het
Supt5	A	G	7: 28,329,320	Y153H	possibly damaging	Het
Tyk2	T	C	9: 21,110,587	T825A	probably benign	Het
Usp20	G	A	2: 31,018,800	V798M	probably benign	Het
Wdr26	A	T	1: 181,211,120	D102E	probably damaging	Het

Other mutations in Nedd1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00764:Nedd1	APN	10	92694974	splice site	probably benign
IGL00988:Nedd1	APN	10	92689686	missense	possibly damaging	0.71
IGL01563:Nedd1	APN	10	92698169	critical splice donor site	probably null
IGL01588:Nedd1	APN	10	92686262	missense	probably benign	0.12
IGL01988:Nedd1	APN	10	92714159	missense	probably benign	0.39
IGL02706:Nedd1	APN	10	92686285	missense	possibly damaging	0.88
IGL02938:Nedd1	APN	10	92689657	nonsense	probably null
IGL03011:Nedd1	APN	10	92689641	missense	possibly damaging	0.92
Brainless	UTSW	10	92690773	missense	probably benign	0.01
R0125:Nedd1	UTSW	10	92691929	missense	possibly damaging	0.93
R0173:Nedd1	UTSW	10	92698883	missense	probably benign	0.30
R0244:Nedd1	UTSW	10	92716265	intron	probably benign
R0645:Nedd1	UTSW	10	92691831	splice site	probably null
R0791:Nedd1	UTSW	10	92719614	missense	probably damaging	1.00
R1490:Nedd1	UTSW	10	92700798	missense	probably damaging	1.00
R1522:Nedd1	UTSW	10	92719614	missense	probably damaging	1.00
R1797:Nedd1	UTSW	10	92698739	missense	possibly damaging	0.46
R1984:Nedd1	UTSW	10	92714160	missense	possibly damaging	0.63
R2474:Nedd1	UTSW	10	92719603	missense	probably damaging	0.99
R2877:Nedd1	UTSW	10	92714126	missense	possibly damaging	0.89
R4694:Nedd1	UTSW	10	92719582	missense	probably benign	0.00
R4798:Nedd1	UTSW	10	92698910	missense	probably benign	0.00
R4830:Nedd1	UTSW	10	92686258	missense	probably damaging	1.00
R4963:Nedd1	UTSW	10	92695031	missense	probably damaging	1.00
R5174:Nedd1	UTSW	10	92711212	missense	possibly damaging	0.77
R5329:Nedd1	UTSW	10	92686240	missense	probably damaging	1.00
R5404:Nedd1	UTSW	10	92716192	missense	probably benign	0.04
R5534:Nedd1	UTSW	10	92695032	missense	probably benign	0.01
R6045:Nedd1	UTSW	10	92695100	nonsense	probably null
R6154:Nedd1	UTSW	10	92698242	missense	possibly damaging	0.65
R6512:Nedd1	UTSW	10	92691875	missense	probably benign
R6692:Nedd1	UTSW	10	92698337	missense	possibly damaging	0.88
R6693:Nedd1	UTSW	10	92698337	missense	possibly damaging	0.88
R6943:Nedd1	UTSW	10	92711306	missense	probably damaging	1.00
R7011:Nedd1	UTSW	10	92690773	missense	probably benign	0.01
R7406:Nedd1	UTSW	10	92711323	splice site	probably null
R7455:Nedd1	UTSW	10	92700925	missense	probably benign	0.01
R7587:Nedd1	UTSW	10	92698730	missense	probably benign	0.01
R7745:Nedd1	UTSW	10	92714172	missense	probably benign
R8104:Nedd1	UTSW	10	92691916	missense	probably damaging	1.00
R8209:Nedd1	UTSW	10	92691935	missense	probably benign
R8226:Nedd1	UTSW	10	92691935	missense	probably benign
R8925:Nedd1	UTSW	10	92722396	start gained	probably benign
R8927:Nedd1	UTSW	10	92722396	start gained	probably benign

Predicted Primers

PCR Primer
(F):5'- CGGGGATTGGAACCATGTAC -3'
(R):5'- TAAACTTGCACCAGGGTGG -3'

Sequencing Primer
(F):5'- CCATGTACAGTGACTAGCATTTGC -3'
(R):5'- ACCAGGGTGGGTAATGTCCATTTTAC -3'

Posted On

2015-01-23