Incidental Mutation 'R2883:Bod1l'
ID260909
Institutional Source Beutler Lab
Gene Symbol Bod1l
Ensembl Gene ENSMUSG00000061755
Gene Namebiorientation of chromosomes in cell division 1-like
SynonymsA230054D04Rik
MMRRC Submission 040471-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.950) question?
Stock #R2883 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location41787538-41844315 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 41832259 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 374 (S374P)
Ref Sequence ENSEMBL: ENSMUSP00000144359 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050556] [ENSMUST00000202908]
Predicted Effect probably benign
Transcript: ENSMUST00000050556
AA Change: S374P

PolyPhen 2 Score 0.033 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000058618
Gene: ENSMUSG00000061755
AA Change: S374P

DomainStartEndE-ValueType
low complexity region 5 47 N/A INTRINSIC
Pfam:COMPASS-Shg1 54 150 1.8e-28 PFAM
low complexity region 328 343 N/A INTRINSIC
low complexity region 415 435 N/A INTRINSIC
low complexity region 475 484 N/A INTRINSIC
coiled coil region 495 520 N/A INTRINSIC
coiled coil region 553 580 N/A INTRINSIC
low complexity region 820 840 N/A INTRINSIC
low complexity region 895 916 N/A INTRINSIC
low complexity region 996 1005 N/A INTRINSIC
low complexity region 1023 1041 N/A INTRINSIC
low complexity region 1272 1286 N/A INTRINSIC
low complexity region 1791 1809 N/A INTRINSIC
low complexity region 2695 2701 N/A INTRINSIC
low complexity region 2711 2729 N/A INTRINSIC
AT_hook 2807 2819 3.21e-1 SMART
coiled coil region 2908 2929 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202200
Predicted Effect probably benign
Transcript: ENSMUST00000202908
AA Change: S374P

PolyPhen 2 Score 0.033 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000144359
Gene: ENSMUSG00000061755
AA Change: S374P

DomainStartEndE-ValueType
low complexity region 5 47 N/A INTRINSIC
Pfam:COMPASS-Shg1 54 150 2.9e-24 PFAM
low complexity region 328 343 N/A INTRINSIC
low complexity region 415 435 N/A INTRINSIC
low complexity region 475 484 N/A INTRINSIC
coiled coil region 495 520 N/A INTRINSIC
coiled coil region 553 580 N/A INTRINSIC
low complexity region 820 840 N/A INTRINSIC
low complexity region 895 916 N/A INTRINSIC
low complexity region 996 1005 N/A INTRINSIC
low complexity region 1023 1041 N/A INTRINSIC
low complexity region 1272 1286 N/A INTRINSIC
low complexity region 1791 1809 N/A INTRINSIC
low complexity region 2695 2701 N/A INTRINSIC
low complexity region 2711 2729 N/A INTRINSIC
AT_hook 2807 2819 1.9e-3 SMART
coiled coil region 2908 2929 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001C19Rik C A 17: 47,436,725 V32F probably damaging Het
1700018B08Rik G A 8: 121,539,905 P81S probably damaging Het
Arhgef10l T C 4: 140,516,802 Q790R probably benign Het
Asic2 T A 11: 80,894,013 I367F possibly damaging Het
Asxl2 T C 12: 3,501,830 S1191P probably benign Het
C1qtnf7 T A 5: 43,615,880 F167I probably damaging Het
Col13a1 A G 10: 61,978,356 L94P probably benign Het
Cped1 A T 6: 22,143,979 T575S probably damaging Het
Cpt1b T C 15: 89,417,869 Y702C probably benign Het
D630039A03Rik T A 4: 57,910,560 N84I probably damaging Het
Dse A T 10: 34,152,507 D862E probably benign Het
Etl4 A T 2: 20,806,174 T1023S possibly damaging Het
Fat4 T A 3: 38,980,804 N2868K probably damaging Het
Fgd5 G A 6: 91,987,109 probably null Het
Fsip2 C T 2: 82,991,524 T5867I possibly damaging Het
Fuca2 A G 10: 13,505,951 T203A probably benign Het
Gli2 T C 1: 118,868,144 I131V probably damaging Het
Gtpbp4 A G 13: 8,990,723 V122A possibly damaging Het
Kif1b G A 4: 149,237,648 T938I possibly damaging Het
Klhl29 T C 12: 5,084,036 D767G probably damaging Het
Mageb3 A G 2: 121,954,366 V285A probably benign Het
Myoc A G 1: 162,639,616 E118G possibly damaging Het
Nedd1 A C 10: 92,694,998 F410V probably damaging Het
Nipal1 A T 5: 72,667,730 K255N probably damaging Het
Npr3 T C 15: 11,883,324 K340E possibly damaging Het
Obsl1 C A 1: 75,496,511 G1023C possibly damaging Het
Ogdh T C 11: 6,334,545 L188P probably damaging Het
Olfr110 C T 17: 37,499,380 S243F probably damaging Het
Olfr1500 T A 19: 13,827,875 I174F probably damaging Het
Olfr616 T C 7: 103,565,264 N5S probably benign Het
Otogl G A 10: 107,768,981 T2188M probably damaging Het
Pck1 G A 2: 173,158,575 V600I probably benign Het
Ranbp17 A G 11: 33,504,708 C42R probably damaging Het
Rapgef4 G A 2: 72,031,125 R53H probably benign Het
Rbm12 G A 2: 156,097,075 H426Y probably damaging Het
Retreg2 C T 1: 75,146,712 P428L probably benign Het
Rev3l G T 10: 39,825,156 S1883I probably damaging Het
Rinl CGGG CGGGGG 7: 28,797,658 probably null Het
Rora T C 9: 69,375,435 S356P probably damaging Het
Slc31a1 T C 4: 62,388,771 V188A probably damaging Het
Slc9a3 A G 13: 74,158,760 K335E probably damaging Het
Spata22 C A 11: 73,344,678 H274N possibly damaging Het
Srrm1 T C 4: 135,321,411 probably benign Het
Stab2 A T 10: 86,967,686 I333N possibly damaging Het
Supt5 A G 7: 28,329,320 Y153H possibly damaging Het
Tyk2 T C 9: 21,110,587 T825A probably benign Het
Usp20 G A 2: 31,018,800 V798M probably benign Het
Wdr26 A T 1: 181,211,120 D102E probably damaging Het
Other mutations in Bod1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00944:Bod1l APN 5 41816823 missense probably benign 0.00
IGL00990:Bod1l APN 5 41828865 missense probably benign 0.00
IGL01021:Bod1l APN 5 41838173 splice site probably benign
IGL01022:Bod1l APN 5 41794309 missense probably damaging 1.00
IGL01303:Bod1l APN 5 41817599 missense probably benign 0.00
IGL01654:Bod1l APN 5 41818176 missense probably damaging 0.99
IGL01748:Bod1l APN 5 41816961 missense probably benign 0.23
IGL01758:Bod1l APN 5 41826610 splice site probably benign
IGL01783:Bod1l APN 5 41808712 missense probably benign 0.02
IGL01790:Bod1l APN 5 41832250 missense probably benign 0.14
IGL01803:Bod1l APN 5 41817389 missense probably damaging 0.97
IGL01829:Bod1l APN 5 41820468 missense probably benign 0.25
IGL01952:Bod1l APN 5 41816954 missense possibly damaging 0.70
IGL02005:Bod1l APN 5 41816339 missense probably benign 0.01
IGL02110:Bod1l APN 5 41816453 missense probably damaging 0.97
IGL02129:Bod1l APN 5 41821850 missense probably benign 0.36
IGL02572:Bod1l APN 5 41821230 nonsense probably null
IGL02583:Bod1l APN 5 41816207 critical splice donor site probably null
IGL02643:Bod1l APN 5 41818805 missense possibly damaging 0.65
IGL02714:Bod1l APN 5 41816339 missense probably benign 0.01
IGL02728:Bod1l APN 5 41826503 missense probably damaging 1.00
IGL02752:Bod1l APN 5 41816463 missense possibly damaging 0.58
IGL02822:Bod1l APN 5 41794345 missense possibly damaging 0.94
IGL03032:Bod1l APN 5 41831584 missense probably benign 0.16
IGL03372:Bod1l APN 5 41805235 splice site probably benign
R0102:Bod1l UTSW 5 41817269 missense probably benign 0.36
R0147:Bod1l UTSW 5 41818697 missense possibly damaging 0.48
R0148:Bod1l UTSW 5 41818697 missense possibly damaging 0.48
R0490:Bod1l UTSW 5 41821892 missense probably damaging 0.96
R0577:Bod1l UTSW 5 41794887 missense probably damaging 1.00
R0587:Bod1l UTSW 5 41821637 missense probably benign 0.16
R0620:Bod1l UTSW 5 41801233 missense probably benign 0.16
R0626:Bod1l UTSW 5 41831537 missense probably damaging 1.00
R0785:Bod1l UTSW 5 41820016 missense probably benign 0.00
R1139:Bod1l UTSW 5 41831471 missense possibly damaging 0.64
R1165:Bod1l UTSW 5 41821053 missense probably benign 0.02
R1418:Bod1l UTSW 5 41819471 missense probably damaging 1.00
R1509:Bod1l UTSW 5 41819540 missense probably damaging 0.99
R1533:Bod1l UTSW 5 41822155 nonsense probably null
R1538:Bod1l UTSW 5 41816429 missense probably benign 0.00
R1591:Bod1l UTSW 5 41819220 missense probably benign 0.06
R1616:Bod1l UTSW 5 41808715 missense probably benign
R1628:Bod1l UTSW 5 41816982 missense probably benign 0.01
R1667:Bod1l UTSW 5 41816775 missense probably benign 0.01
R1869:Bod1l UTSW 5 41833675 missense possibly damaging 0.93
R1870:Bod1l UTSW 5 41833675 missense possibly damaging 0.93
R1993:Bod1l UTSW 5 41817336 missense probably damaging 1.00
R2060:Bod1l UTSW 5 41808742 missense possibly damaging 0.58
R2066:Bod1l UTSW 5 41805156 missense probably damaging 0.99
R2067:Bod1l UTSW 5 41817086 missense probably benign 0.11
R2073:Bod1l UTSW 5 41819189 missense probably benign 0.19
R2092:Bod1l UTSW 5 41831517 missense probably damaging 1.00
R2105:Bod1l UTSW 5 41832279 missense probably benign 0.00
R2243:Bod1l UTSW 5 41821545 missense possibly damaging 0.58
R2322:Bod1l UTSW 5 41827120 missense probably benign 0.09
R2849:Bod1l UTSW 5 41838076 missense probably damaging 1.00
R3037:Bod1l UTSW 5 41822037 missense probably damaging 0.99
R3910:Bod1l UTSW 5 41817098 missense probably damaging 0.99
R3911:Bod1l UTSW 5 41817098 missense probably damaging 0.99
R3962:Bod1l UTSW 5 41808721 missense probably benign 0.07
R4235:Bod1l UTSW 5 41821455 missense probably damaging 1.00
R4308:Bod1l UTSW 5 41791813 missense possibly damaging 0.91
R4414:Bod1l UTSW 5 41820527 missense probably benign 0.04
R4535:Bod1l UTSW 5 41832231 missense probably benign 0.06
R4631:Bod1l UTSW 5 41817735 missense probably damaging 1.00
R4657:Bod1l UTSW 5 41818612 missense probably benign 0.00
R4782:Bod1l UTSW 5 41833663 missense probably benign 0.06
R4786:Bod1l UTSW 5 41819438 missense probably benign 0.43
R4840:Bod1l UTSW 5 41818472 missense probably damaging 1.00
R4877:Bod1l UTSW 5 41819994 missense probably benign 0.00
R4982:Bod1l UTSW 5 41820473 missense probably benign 0.00
R5152:Bod1l UTSW 5 41816543 missense probably benign 0.04
R5284:Bod1l UTSW 5 41820467 missense probably benign 0.05
R5354:Bod1l UTSW 5 41831537 missense probably damaging 1.00
R5369:Bod1l UTSW 5 41827183 missense probably damaging 1.00
R5486:Bod1l UTSW 5 41807181 missense possibly damaging 0.56
R5541:Bod1l UTSW 5 41791933 missense probably benign 0.06
R5610:Bod1l UTSW 5 41821874 missense probably damaging 1.00
R5655:Bod1l UTSW 5 41817044 missense probably benign 0.06
R5705:Bod1l UTSW 5 41817002 missense probably benign 0.01
R5819:Bod1l UTSW 5 41832605 missense probably benign 0.27
R5890:Bod1l UTSW 5 41820578 missense probably benign 0.43
R5923:Bod1l UTSW 5 41817419 missense probably damaging 1.00
R5991:Bod1l UTSW 5 41816863 nonsense probably null
R6017:Bod1l UTSW 5 41818760 missense probably benign 0.01
R6253:Bod1l UTSW 5 41826538 missense probably damaging 0.96
R6284:Bod1l UTSW 5 41818787 missense probably benign 0.35
R6483:Bod1l UTSW 5 41821082 missense probably benign 0.03
R6485:Bod1l UTSW 5 41817116 missense possibly damaging 0.93
R6575:Bod1l UTSW 5 41838068 missense probably damaging 1.00
R6679:Bod1l UTSW 5 41816666 missense probably damaging 0.97
R6788:Bod1l UTSW 5 41821873 nonsense probably null
R7006:Bod1l UTSW 5 41832552 missense probably damaging 1.00
R7095:Bod1l UTSW 5 41795068 critical splice donor site probably null
R7111:Bod1l UTSW 5 41813120 critical splice donor site probably null
R7190:Bod1l UTSW 5 41819938 missense probably benign 0.14
R7311:Bod1l UTSW 5 41794333 missense possibly damaging 0.57
R7336:Bod1l UTSW 5 41821524 missense probably damaging 1.00
R7341:Bod1l UTSW 5 41788857 missense probably benign 0.00
R7396:Bod1l UTSW 5 41831546 missense probably damaging 1.00
R7431:Bod1l UTSW 5 41813120 critical splice donor site probably null
R7442:Bod1l UTSW 5 41807179 missense probably damaging 0.96
R7539:Bod1l UTSW 5 41817860 missense possibly damaging 0.65
R7583:Bod1l UTSW 5 41833790 missense probably damaging 1.00
R7679:Bod1l UTSW 5 41820643 frame shift probably null
R7748:Bod1l UTSW 5 41832340 missense probably damaging 0.97
R7767:Bod1l UTSW 5 41816756 missense probably benign 0.01
R7773:Bod1l UTSW 5 41832712 missense probably benign 0.14
R7782:Bod1l UTSW 5 41817943 missense probably benign 0.01
R7860:Bod1l UTSW 5 41819265 missense probably damaging 1.00
R7975:Bod1l UTSW 5 41816277 missense possibly damaging 0.90
R7977:Bod1l UTSW 5 41795070 missense probably damaging 1.00
R7987:Bod1l UTSW 5 41795070 missense probably damaging 1.00
R8104:Bod1l UTSW 5 41833732 nonsense probably null
R8217:Bod1l UTSW 5 41831507 missense probably damaging 1.00
R8307:Bod1l UTSW 5 41821155 missense probably damaging 1.00
R8469:Bod1l UTSW 5 41821491 missense possibly damaging 0.86
R8506:Bod1l UTSW 5 41819055 nonsense probably null
R8934:Bod1l UTSW 5 41819601 missense probably benign 0.11
X0027:Bod1l UTSW 5 41832669 missense probably benign 0.20
X0058:Bod1l UTSW 5 41824018 missense probably damaging 1.00
Z1088:Bod1l UTSW 5 41808764 missense possibly damaging 0.95
Z1088:Bod1l UTSW 5 41821146 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGTGCACAGCGTAGTACTTTTATTG -3'
(R):5'- TCAGCAGGAAAGCACTGACC -3'

Sequencing Primer
(F):5'- ACAGCGTAGTACTTTTATTGCTTTAC -3'
(R):5'- GCACTGACCCAAAAATTAAATCAATG -3'
Posted On2015-01-23