Incidental Mutation 'I1329:Cercam'
ID26479
Institutional Source Beutler Lab
Gene Symbol Cercam
Ensembl Gene ENSMUSG00000039787
Gene Namecerebral endothelial cell adhesion molecule
SynonymsCeecam1, CerCAM
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #I1329 (G1) of strain toku
Quality Score225
Status Validated (trace)
Chromosome2
Chromosomal Location29869164-29882840 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 29871085 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 132 (V132E)
Ref Sequence ENSEMBL: ENSMUSP00000115902 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047521] [ENSMUST00000134152] [ENSMUST00000154464]
Predicted Effect possibly damaging
Transcript: ENSMUST00000047521
AA Change: V84E

PolyPhen 2 Score 0.458 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000041622
Gene: ENSMUSG00000039787
AA Change: V84E

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Glyco_tranf_2_4 37 157 2.6e-15 PFAM
Pfam:Glyco_transf_25 316 500 3.2e-33 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000047607
SMART Domains Protein: ENSMUSP00000047152
Gene: ENSMUSG00000039798

DomainStartEndE-ValueType
low complexity region 23 32 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000134152
AA Change: V132E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000115902
Gene: ENSMUSG00000039787
AA Change: V132E

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153863
Predicted Effect probably damaging
Transcript: ENSMUST00000154464
AA Change: V49E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000119476
Gene: ENSMUSG00000039787
AA Change: V49E

DomainStartEndE-ValueType
low complexity region 11 28 N/A INTRINSIC
Meta Mutation Damage Score 0.4034 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.9%
  • 20x: 95.2%
Validation Efficiency 89% (42/47)
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406P16Rik A G 7: 34,245,194 S542P probably benign Het
Adamts13 T C 2: 26,973,619 I28T possibly damaging Het
Agbl4 T A 4: 110,478,455 probably benign Het
Aspscr1 G C 11: 120,701,240 V268L probably damaging Het
Btbd10 A G 7: 113,332,875 S115P probably benign Het
Decr1 G A 4: 15,930,976 R119* probably null Het
Dlst T C 12: 85,123,841 M248T probably damaging Het
Erbb3 T C 10: 128,583,454 N215S possibly damaging Het
Flnc G A 6: 29,451,415 V1543M probably damaging Het
Gk5 GCC GC 9: 96,140,629 probably null Het
Glrb T A 3: 80,862,074 R115S probably damaging Het
Gm5592 T A 7: 41,286,354 Y93* probably null Het
Gpr20 C T 15: 73,695,763 R259H probably damaging Het
Il1rap A G 16: 26,692,850 T215A probably benign Het
Ipmk T C 10: 71,381,447 C275R possibly damaging Het
Lats1 A G 10: 7,712,802 N1061S probably benign Het
Nkain3 A G 4: 20,158,329 probably benign Het
Nr1h4 A G 10: 89,483,362 probably benign Het
Nr4a3 A G 4: 48,051,585 Q142R probably benign Het
Otog G A 7: 46,246,503 V131I probably benign Het
Parp12 A T 6: 39,087,571 M627K probably damaging Het
Pcdh9 A G 14: 93,886,209 S842P probably benign Het
Phc2 G C 4: 128,711,113 G214A probably damaging Het
Prpf40a C A 2: 53,176,395 V92L probably benign Het
Qser1 A T 2: 104,786,977 Y1163* probably null Het
Rpe65 A G 3: 159,624,723 D509G probably benign Het
Scin T A 12: 40,073,330 N518I probably damaging Het
Sfswap G T 5: 129,507,137 probably benign Het
Tfpi A T 2: 84,444,116 N182K possibly damaging Het
Tph1 A G 7: 46,650,013 L368P probably damaging Het
Ttn T C 2: 76,741,572 T26326A possibly damaging Het
Ubr1 G A 2: 120,934,294 probably benign Het
Usf3 G T 16: 44,220,530 C1791F probably damaging Het
Vmn1r16 T G 6: 57,323,534 R34S probably damaging Het
Ylpm1 C A 12: 85,040,880 P1604Q probably damaging Het
Zc3h12a A G 4: 125,119,364 V569A possibly damaging Het
Zmynd8 A G 2: 165,828,225 F488S probably damaging Het
Other mutations in Cercam
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01885:Cercam APN 2 29881003 missense probably damaging 1.00
IGL02619:Cercam APN 2 29880674 missense probably benign 0.05
IGL03088:Cercam APN 2 29881687 splice site probably benign
P0042:Cercam UTSW 2 29881083 missense probably damaging 1.00
R0086:Cercam UTSW 2 29871064 missense probably damaging 1.00
R0829:Cercam UTSW 2 29871067 missense probably damaging 0.98
R1442:Cercam UTSW 2 29880640 missense probably benign
R1558:Cercam UTSW 2 29876239 missense probably benign 0.35
R1997:Cercam UTSW 2 29872923 missense probably benign 0.11
R4678:Cercam UTSW 2 29869677 missense probably damaging 1.00
R4889:Cercam UTSW 2 29881833 missense probably damaging 0.96
R4891:Cercam UTSW 2 29869271 unclassified probably benign
R4967:Cercam UTSW 2 29871021 critical splice acceptor site probably null
R5052:Cercam UTSW 2 29875627 missense probably damaging 1.00
R5541:Cercam UTSW 2 29875629 missense probably benign
R5650:Cercam UTSW 2 29881815 missense probably damaging 1.00
R7072:Cercam UTSW 2 29881924 missense probably benign 0.00
R7422:Cercam UTSW 2 29872880 missense possibly damaging 0.81
R7585:Cercam UTSW 2 29881731 missense probably damaging 1.00
R7725:Cercam UTSW 2 29872562 critical splice acceptor site probably null
R7730:Cercam UTSW 2 29872562 critical splice acceptor site probably null
R7747:Cercam UTSW 2 29871286 missense probably benign 0.02
RF016:Cercam UTSW 2 29869305 missense unknown
Predicted Primers PCR Primer
(F):5'- CGTGGCAGGTGCAATCTTTAAGCTC -3'
(R):5'- TTACCAGGATGTAGTCAGCTCCCC -3'

Sequencing Primer
(F):5'- aggggcttgcttgatgtg -3'
(R):5'- AAAGGCCAGTGCTTCCTG -3'
Posted On2013-04-16