Incidental Mutation 'R3412:Il4i1'
ID267765
Institutional Source Beutler Lab
Gene Symbol Il4i1
Ensembl Gene ENSMUSG00000074141
Gene Nameinterleukin 4 induced 1
SynonymsFig1-ps, Fig1
MMRRC Submission 040630-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3412 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location44816387-44840809 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 44836658 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 22 (L22P)
Ref Sequence ENSEMBL: ENSMUSP00000113726 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033015] [ENSMUST00000047085] [ENSMUST00000118125] [ENSMUST00000145959]
Predicted Effect unknown
Transcript: ENSMUST00000033015
AA Change: L14P
SMART Domains Protein: ENSMUSP00000033015
Gene: ENSMUSG00000074141
AA Change: L14P

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:AlaDh_PNT_C 42 93 1.3e-9 PFAM
Pfam:Thi4 53 100 1.8e-8 PFAM
Pfam:FAD_binding_3 59 94 1.4e-7 PFAM
Pfam:HI0933_like 59 161 1.3e-8 PFAM
Pfam:FAD_binding_2 60 100 1.5e-8 PFAM
Pfam:Pyr_redox 60 100 1.9e-8 PFAM
Pfam:Pyr_redox_2 60 125 7.3e-8 PFAM
Pfam:DAO 60 140 2.8e-9 PFAM
Pfam:NAD_binding_8 63 130 3.6e-17 PFAM
Pfam:Amino_oxidase 68 503 9.9e-86 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000047085
SMART Domains Protein: ENSMUSP00000048260
Gene: ENSMUSG00000038520

DomainStartEndE-ValueType
Pfam:DUF3548 3 217 8.2e-93 PFAM
low complexity region 249 259 N/A INTRINSIC
TBC 307 545 3.93e-54 SMART
Blast:TBC 554 594 1e-6 BLAST
low complexity region 597 631 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000118125
AA Change: L22P

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000113726
Gene: ENSMUSG00000074141
AA Change: L22P

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:AlaDh_PNT_C 47 111 6.6e-9 PFAM
Pfam:Pyr_redox_2 47 111 2e-9 PFAM
Pfam:HI0933_like 67 169 1.8e-8 PFAM
Pfam:FAD_binding_2 68 108 5e-8 PFAM
Pfam:Pyr_redox 68 109 8.5e-8 PFAM
Pfam:DAO 68 159 5.6e-8 PFAM
Pfam:NAD_binding_8 71 138 1.2e-15 PFAM
Pfam:Amino_oxidase 76 511 5.9e-84 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124695
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130081
Predicted Effect probably benign
Transcript: ENSMUST00000133279
SMART Domains Protein: ENSMUSP00000133613
Gene: ENSMUSG00000074141

DomainStartEndE-ValueType
PDB:1TDO|A 2 44 1e-8 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139947
Predicted Effect probably benign
Transcript: ENSMUST00000145959
SMART Domains Protein: ENSMUSP00000121546
Gene: ENSMUSG00000038520

DomainStartEndE-ValueType
Pfam:DUF3548 3 217 5.8e-93 PFAM
low complexity region 249 259 N/A INTRINSIC
TBC 307 544 3.91e-40 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149686
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149779
Predicted Effect probably benign
Transcript: ENSMUST00000208714
Meta Mutation Damage Score 0.6385 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 98% (40/41)
MGI Phenotype PHENOTYPE: Homozygous mutation of this gene results in no obvious phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adarb2 T C 13: 8,752,618 F643S probably damaging Het
Ap2a2 T A 7: 141,598,776 N105K probably benign Het
Arhgef5 A G 6: 43,273,790 I492V probably benign Het
Atp8b4 C A 2: 126,375,757 W613L probably damaging Het
Ccdc162 T C 10: 41,539,549 probably benign Het
Diexf A C 1: 193,128,502 S64R possibly damaging Het
Esp24 T A 17: 39,038,316 I11N possibly damaging Het
Exoc4 A G 6: 33,265,975 E41G probably damaging Het
Eya1 T A 1: 14,274,209 probably null Het
Gckr T A 5: 31,300,867 probably null Het
Gm4981 G A 10: 58,236,353 T13I possibly damaging Het
Gria4 T A 9: 4,513,278 D277V probably benign Het
Il18r1 A T 1: 40,491,067 D318V probably damaging Het
Inpp5d C A 1: 87,668,057 T175N possibly damaging Het
Krt90 T A 15: 101,560,593 L171F probably damaging Het
Mthfd1 A G 12: 76,303,749 probably null Het
Olfr262 T C 19: 12,241,590 I24V probably benign Het
Olfr561 T C 7: 102,774,755 L77P possibly damaging Het
Olfr635 T C 7: 103,979,402 L76P probably damaging Het
Olfr786 A T 10: 129,437,307 D165V probably damaging Het
Pla2g4f T C 2: 120,303,106 S579G probably benign Het
Ppef2 T G 5: 92,228,722 S649R probably damaging Het
Prss43 G C 9: 110,829,464 Q277H probably damaging Het
Ramp2 TTGCTGCTGCTGCTGCTGCTGCTG TTGCTGCTGCTGCTGCTGCTG 11: 101,246,545 probably benign Het
Rusc2 T G 4: 43,415,935 S414A probably damaging Het
Sez6l A G 5: 112,475,361 L108P possibly damaging Het
Slc12a5 A G 2: 164,968,431 D10G probably benign Het
Slc1a7 A G 4: 108,010,994 E497G probably benign Het
Sos1 T C 17: 80,406,717 D1108G probably benign Het
Spag8 T A 4: 43,651,606 S423C probably damaging Het
Tacc2 A G 7: 130,734,994 T2369A probably benign Het
Taok2 T C 7: 126,870,858 I933V possibly damaging Het
Tex9 C A 9: 72,477,758 Q265H possibly damaging Het
Trim69 T C 2: 122,178,644 V395A probably benign Het
Tusc1 C A 4: 93,334,936 R162L probably damaging Het
Ubr5 T C 15: 38,004,235 probably benign Het
Zfyve28 C T 5: 34,199,684 M723I probably benign Het
Zmynd8 A T 2: 165,815,451 M533K probably damaging Het
Other mutations in Il4i1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00863:Il4i1 APN 7 44838046 nonsense probably null
IGL03366:Il4i1 APN 7 44837495 unclassified probably benign
R0945:Il4i1 UTSW 7 44839704 missense probably damaging 1.00
R1248:Il4i1 UTSW 7 44839789 missense probably damaging 1.00
R1559:Il4i1 UTSW 7 44839387 missense probably damaging 0.98
R2099:Il4i1 UTSW 7 44838192 critical splice donor site probably null
R2131:Il4i1 UTSW 7 44840070 missense probably damaging 0.98
R2212:Il4i1 UTSW 7 44836658 missense probably damaging 0.99
R2516:Il4i1 UTSW 7 44839891 missense probably damaging 1.00
R2893:Il4i1 UTSW 7 44837990 missense probably damaging 0.98
R3414:Il4i1 UTSW 7 44836658 missense probably damaging 0.99
R5493:Il4i1 UTSW 7 44840053 missense possibly damaging 0.56
R6156:Il4i1 UTSW 7 44840184 missense possibly damaging 0.53
R6239:Il4i1 UTSW 7 44840412 missense probably benign
R6422:Il4i1 UTSW 7 44840136 missense probably damaging 0.99
R6813:Il4i1 UTSW 7 44839812 missense probably benign 0.44
R6866:Il4i1 UTSW 7 44836539 critical splice donor site probably null
R7543:Il4i1 UTSW 7 44836775 missense possibly damaging 0.79
R7673:Il4i1 UTSW 7 44840362 missense probably benign
Predicted Primers PCR Primer
(F):5'- CTTCTTCACTCAGACAGCAGC -3'
(R):5'- AGGACTACAGGCAGCACTTCTC -3'

Sequencing Primer
(F):5'- AGACAGCAGCTGCCACTTGAG -3'
(R):5'- GCATCACTGAGCATCTTGGCTG -3'
Posted On2015-02-18