Incidental Mutation 'R3424:Oxtr'
ID267848
Institutional Source Beutler Lab
Gene Symbol Oxtr
Ensembl Gene ENSMUSG00000049112
Gene Nameoxytocin receptor
SynonymsOTR
MMRRC Submission 040642-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3424 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location112473683-112489943 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 112477230 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 24 (H24Q)
Ref Sequence ENSEMBL: ENSMUSP00000145300 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053306] [ENSMUST00000075477] [ENSMUST00000204027]
Predicted Effect probably benign
Transcript: ENSMUST00000053306
AA Change: H337Q

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000051132
Gene: ENSMUSG00000049112
AA Change: H337Q

DomainStartEndE-ValueType
Pfam:7tm_4 46 183 2.5e-8 PFAM
Pfam:7TM_GPCR_Srsx 50 339 1.4e-6 PFAM
Pfam:7tm_1 56 328 3.4e-46 PFAM
low complexity region 365 387 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000075477
SMART Domains Protein: ENSMUSP00000074922
Gene: ENSMUSG00000062694

DomainStartEndE-ValueType
Pfam:Caveolin 15 148 9.5e-61 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000204027
AA Change: H24Q

PolyPhen 2 Score 0.313 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000145300
Gene: ENSMUSG00000049112
AA Change: H24Q

DomainStartEndE-ValueType
SCOP:d1l9ha_ 2 56 2e-6 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the G-protein coupled receptor family and acts as a receptor for oxytocin. Its activity is mediated by G proteins which activate a phosphatidylinositol-calcium second messenger system. The oxytocin-oxytocin receptor system plays an important role in the uterus during parturition. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null females fail to lactate and exhibit decreased maternal behavior. Males exhibit an increase in aggression, hypoactivity and vocalization in response to social isolation, and social amnesia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6030469F06Rik G T 12: 31,184,633 noncoding transcript Het
Atp8b3 T C 10: 80,536,347 E16G probably benign Het
BC016579 T A 16: 45,629,483 I191F probably damaging Het
Cdh23 T G 10: 60,376,881 I1584L possibly damaging Het
Cep250 G A 2: 155,981,461 D1011N probably benign Het
Coro2b A T 9: 62,429,308 probably null Het
Csf3r A G 4: 126,043,756 D811G probably damaging Het
Dst T G 1: 34,198,505 probably benign Het
Gabrr1 T C 4: 33,158,058 L227P probably damaging Het
Galnt10 T C 11: 57,645,713 V52A probably benign Het
Golga4 A C 9: 118,534,647 D229A probably benign Het
Heatr5b G A 17: 78,768,404 T1495I possibly damaging Het
Hoxd4 A G 2: 74,727,313 Y12C probably damaging Het
Hps1 A T 19: 42,760,513 M522K possibly damaging Het
Lrrc8e A T 8: 4,234,611 I279F probably damaging Het
Mettl24 C T 10: 40,683,641 Q96* probably null Het
Muc2 A G 7: 141,693,352 N193S probably damaging Het
Mysm1 A G 4: 94,965,321 L347P probably benign Het
Olfr979 T A 9: 40,000,534 E231V probably damaging Het
Paxip1 A G 5: 27,775,673 probably benign Het
Pclo C T 5: 14,680,418 probably benign Het
Ros1 C A 10: 52,128,416 probably null Het
Slc18b1 T G 10: 23,822,976 M348R probably damaging Het
Slco4c1 A T 1: 96,841,251 S295R probably benign Het
Tmeff2 A G 1: 50,979,617 probably benign Het
Tspan31 T A 10: 127,068,502 Q141L probably benign Het
Virma G T 4: 11,513,177 E344* probably null Het
Zbtb17 G T 4: 141,464,988 G415C probably damaging Het
Other mutations in Oxtr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02418:Oxtr APN 6 112477239 missense probably damaging 1.00
R0610:Oxtr UTSW 6 112477177 missense probably benign 0.08
R0635:Oxtr UTSW 6 112489200 missense probably damaging 1.00
R0924:Oxtr UTSW 6 112489637 splice site probably null
R0930:Oxtr UTSW 6 112489637 splice site probably null
R0959:Oxtr UTSW 6 112477177 missense probably benign 0.08
R0961:Oxtr UTSW 6 112477177 missense probably benign 0.08
R1099:Oxtr UTSW 6 112477177 missense probably benign 0.08
R1101:Oxtr UTSW 6 112477177 missense probably benign 0.08
R1102:Oxtr UTSW 6 112477177 missense probably benign 0.08
R1344:Oxtr UTSW 6 112477177 missense probably benign 0.08
R1401:Oxtr UTSW 6 112477177 missense probably benign 0.08
R1682:Oxtr UTSW 6 112477177 missense probably benign 0.08
R2254:Oxtr UTSW 6 112489106 missense probably damaging 0.98
R3805:Oxtr UTSW 6 112477186 missense probably benign 0.14
R4598:Oxtr UTSW 6 112489752 missense probably benign 0.20
R5757:Oxtr UTSW 6 112477261 missense probably damaging 1.00
R5821:Oxtr UTSW 6 112489496 missense probably damaging 1.00
R6667:Oxtr UTSW 6 112477099 unclassified probably benign
Z1176:Oxtr UTSW 6 112489695 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TATACAGCTCCATGCACAGC -3'
(R):5'- AGTGGTACCTGGGATGACTG -3'

Sequencing Primer
(F):5'- AAGATCGGCGGCTACACC -3'
(R):5'- ACCTGGGATGACTGTTGCTG -3'
Posted On2015-02-18