Mutagenetix > Incidental Mutation

Incidental Mutation 'R3699:Chd2'

269919

Institutional Source

Beutler Lab

Gene Symbol

Chd2

Ensembl Gene

ENSMUSG00000078671

Gene Name

chromodomain helicase DNA binding protein 2

Synonyms

5630401D06Rik, 2810013C04Rik, 2810040A01Rik

MMRRC Submission

040692-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.613) question?

Stock #

R3699 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

73076400-73191494 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 73118238 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Isoleucine at position 1127 (L1127I)

Ref Sequence

ENSEMBL: ENSMUSP00000126352 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000169922]

AlphaFold

E9PZM4

Predicted Effect

probably benign
Transcript: ENSMUST00000169922
AA Change: L1127I

PolyPhen 2 Score 0.347 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000126352
Gene: ENSMUSG00000078671
AA Change: L1127I

Domain	Start	End	E-Value	Type
low complexity region	13	75	N/A	INTRINSIC
low complexity region	80	91	N/A	INTRINSIC
low complexity region	126	136	N/A	INTRINSIC
low complexity region	176	196	N/A	INTRINSIC
low complexity region	235	244	N/A	INTRINSIC
CHROMO	260	346	3.64e-19	SMART
CHROMO	376	449	7.99e-16	SMART
DEXDc	480	677	1.93e-37	SMART
Blast:DEXDc	678	729	2e-18	BLAST
low complexity region	793	806	N/A	INTRINSIC
HELICc	821	905	1.2e-24	SMART
Blast:DEXDc	960	1244	4e-63	BLAST
PDB:4B4C\|A	1128	1316	5e-78	PDB
low complexity region	1317	1329	N/A	INTRINSIC
low complexity region	1338	1351	N/A	INTRINSIC
low complexity region	1389	1403	N/A	INTRINSIC
low complexity region	1407	1441	N/A	INTRINSIC
DUF4208	1451	1555	1.85e-52	SMART
low complexity region	1557	1572	N/A	INTRINSIC
low complexity region	1704	1729	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000199809
AA Change: L33I

Meta Mutation Damage Score

0.1780

Coding Region Coverage

1x: 99.1%
3x: 98.6%
10x: 97.2%
20x: 94.8%

Validation Efficiency

100% (33/33)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The CHD family of proteins is characterized by the presence of chromo (chromatin organization modifier) domains and SNF2-related helicase/ATPase domains. CHD genes alter gene expression possibly by modification of chromatin structure thus altering access of the transcriptional apparatus to its chromosomal DNA template. Alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit early postnatal lethality associated with fetal growth retardation. Mice heterozygous for a gene trap allele exhibit postnatal lethality and premature death after weaning associated with growth retardation and multi-organ defects. [provided by MGI curators]

Allele List at MGI

All alleles(169) : Targeted, knock-out(1) Gene trapped(168)

Other mutations in this stock

Total: 29 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ankrd29	G	A	18: 12,387,757 (GRCm39)	A275V	possibly damaging	Het
Atp1b2	G	A	11: 69,496,095 (GRCm39)	T35I	probably benign	Het
Baz1a	A	G	12: 54,963,831 (GRCm39)	V751A	probably benign	Het
Cdh23	C	A	10: 60,163,149 (GRCm39)		probably null	Het
D7Ertd443e	A	G	7: 133,950,797 (GRCm39)	L292P	probably damaging	Het
Dst	T	C	1: 34,252,155 (GRCm39)		probably benign	Het
Dync2i1	C	T	12: 116,175,462 (GRCm39)	W905*	probably null	Het
Gm8229	T	A	14: 44,603,984 (GRCm39)	S58T	unknown	Het
Gucy2c	A	T	6: 136,747,109 (GRCm39)	C117S	probably damaging	Het
Kirrel1	C	T	3: 86,996,458 (GRCm39)	M380I	probably null	Het
Klhl18	A	G	9: 110,265,134 (GRCm39)	Y291H	probably benign	Het
Lamc1	G	T	1: 153,130,951 (GRCm39)	S333R	possibly damaging	Het
Lbr	T	C	1: 181,646,485 (GRCm39)	Y479C	probably damaging	Het
Nampt	T	C	12: 32,898,758 (GRCm39)		probably benign	Het
Or10am5	A	G	7: 6,517,993 (GRCm39)	M145T	probably damaging	Het
Pcnx3	G	T	19: 5,722,493 (GRCm39)	R1400S	probably damaging	Het
Pde4b	C	T	4: 102,458,742 (GRCm39)	A466V	probably damaging	Het
Piezo1	C	T	8: 123,221,642 (GRCm39)	R584H	probably damaging	Het
Polq	C	A	16: 36,862,518 (GRCm39)	S338Y	probably damaging	Het
Pramel26	A	G	4: 143,536,922 (GRCm39)	S470P	probably benign	Het
Rassf8	T	C	6: 145,765,802 (GRCm39)		probably benign	Het
Rere	A	T	4: 150,561,819 (GRCm39)		probably null	Het
Rps6kb1	A	G	11: 86,423,620 (GRCm39)	F120S	probably damaging	Het
Scarf1	G	T	11: 75,405,195 (GRCm39)	C78F	probably damaging	Het
Tepsin	C	T	11: 119,982,579 (GRCm39)	C491Y	possibly damaging	Het
Trpv4	A	G	5: 114,772,861 (GRCm39)	S243P	probably damaging	Het
Whrn	A	T	4: 63,379,649 (GRCm39)		probably benign	Het
Zfp521	G	T	18: 13,979,330 (GRCm39)	S361*	probably null	Het
Zfyve19	A	G	2: 119,041,720 (GRCm39)	T96A	probably benign	Het

Other mutations in Chd2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00232:Chd2	APN	7	73,118,325 (GRCm39)	missense	probably damaging	0.99
IGL00535:Chd2	APN	7	73,190,576 (GRCm39)	missense	probably benign	0.01
IGL00961:Chd2	APN	7	73,093,997 (GRCm39)	missense	probably damaging	0.99
IGL01092:Chd2	APN	7	73,091,434 (GRCm39)	missense	possibly damaging	0.69
IGL02035:Chd2	APN	7	73,091,375 (GRCm39)	splice site	probably null
IGL02083:Chd2	APN	7	73,130,816 (GRCm39)	missense	possibly damaging	0.95
IGL02205:Chd2	APN	7	73,091,465 (GRCm39)	missense	probably benign	0.01
IGL02243:Chd2	APN	7	73,147,456 (GRCm39)	splice site	probably null
IGL02385:Chd2	APN	7	73,085,570 (GRCm39)	missense	probably damaging	1.00
IGL02552:Chd2	APN	7	73,097,068 (GRCm39)	unclassified	probably benign
IGL02590:Chd2	APN	7	73,102,948 (GRCm39)	missense	probably benign	0.00
IGL02684:Chd2	APN	7	73,125,097 (GRCm39)	missense	probably damaging	0.99
IGL02731:Chd2	APN	7	73,143,204 (GRCm39)	missense	probably damaging	0.99
IGL03272:Chd2	APN	7	73,102,914 (GRCm39)	missense	possibly damaging	0.94
1mM(1):Chd2	UTSW	7	73,151,852 (GRCm39)	missense	possibly damaging	0.65
A4554:Chd2	UTSW	7	73,130,716 (GRCm39)	missense	probably benign
F6893:Chd2	UTSW	7	73,157,620 (GRCm39)	missense	possibly damaging	0.92
R0012:Chd2	UTSW	7	73,105,267 (GRCm39)	missense	probably damaging	1.00
R0012:Chd2	UTSW	7	73,105,267 (GRCm39)	missense	probably damaging	1.00
R0068:Chd2	UTSW	7	73,134,282 (GRCm39)	missense	probably damaging	1.00
R0763:Chd2	UTSW	7	73,097,022 (GRCm39)	missense	possibly damaging	0.74
R0973:Chd2	UTSW	7	73,128,412 (GRCm39)	missense	probably damaging	1.00
R0973:Chd2	UTSW	7	73,128,412 (GRCm39)	missense	probably damaging	1.00
R0974:Chd2	UTSW	7	73,128,412 (GRCm39)	missense	probably damaging	1.00
R1223:Chd2	UTSW	7	73,134,265 (GRCm39)	missense	probably damaging	1.00
R1435:Chd2	UTSW	7	73,102,884 (GRCm39)	missense	probably damaging	0.99
R1527:Chd2	UTSW	7	73,140,362 (GRCm39)	nonsense	probably null
R1599:Chd2	UTSW	7	73,122,799 (GRCm39)	missense	probably benign	0.05
R1657:Chd2	UTSW	7	73,130,178 (GRCm39)	missense	probably damaging	1.00
R1932:Chd2	UTSW	7	73,104,193 (GRCm39)	missense	probably damaging	0.99
R2110:Chd2	UTSW	7	73,079,735 (GRCm39)	missense	probably benign	0.00
R2202:Chd2	UTSW	7	73,128,416 (GRCm39)	missense	probably benign	0.00
R2383:Chd2	UTSW	7	73,153,168 (GRCm39)	missense	possibly damaging	0.89
R2393:Chd2	UTSW	7	73,157,631 (GRCm39)	missense	possibly damaging	0.92
R3713:Chd2	UTSW	7	73,121,538 (GRCm39)	unclassified	probably benign
R3788:Chd2	UTSW	7	73,096,878 (GRCm39)	unclassified	probably benign
R3826:Chd2	UTSW	7	73,141,163 (GRCm39)	missense	possibly damaging	0.71
R3828:Chd2	UTSW	7	73,141,163 (GRCm39)	missense	possibly damaging	0.71
R3830:Chd2	UTSW	7	73,141,163 (GRCm39)	missense	possibly damaging	0.71
R3966:Chd2	UTSW	7	73,114,143 (GRCm39)	splice site	probably benign
R4093:Chd2	UTSW	7	73,150,764 (GRCm39)	missense	possibly damaging	0.70
R4431:Chd2	UTSW	7	73,085,709 (GRCm39)	missense	possibly damaging	0.56
R4461:Chd2	UTSW	7	73,190,622 (GRCm39)	intron	probably benign
R4782:Chd2	UTSW	7	73,134,184 (GRCm39)	missense	possibly damaging	0.80
R4791:Chd2	UTSW	7	73,118,325 (GRCm39)	missense	probably benign	0.13
R4792:Chd2	UTSW	7	73,118,325 (GRCm39)	missense	probably benign	0.13
R4799:Chd2	UTSW	7	73,134,184 (GRCm39)	missense	possibly damaging	0.80
R4832:Chd2	UTSW	7	73,151,873 (GRCm39)	missense	probably damaging	1.00
R5055:Chd2	UTSW	7	73,130,256 (GRCm39)	missense	probably damaging	1.00
R5071:Chd2	UTSW	7	73,079,437 (GRCm39)	missense	probably benign	0.03
R5328:Chd2	UTSW	7	73,113,429 (GRCm39)	missense	possibly damaging	0.96
R5444:Chd2	UTSW	7	73,122,833 (GRCm39)	missense	probably damaging	1.00
R5643:Chd2	UTSW	7	73,134,232 (GRCm39)	missense	probably damaging	1.00
R5666:Chd2	UTSW	7	73,091,465 (GRCm39)	missense	probably benign	0.01
R5670:Chd2	UTSW	7	73,091,465 (GRCm39)	missense	probably benign	0.01
R5706:Chd2	UTSW	7	73,141,105 (GRCm39)	missense	possibly damaging	0.74
R5825:Chd2	UTSW	7	73,134,350 (GRCm39)	splice site	probably null
R5834:Chd2	UTSW	7	73,128,463 (GRCm39)	missense	probably damaging	1.00
R5920:Chd2	UTSW	7	73,187,060 (GRCm39)	missense	probably damaging	0.97
R6051:Chd2	UTSW	7	73,085,590 (GRCm39)	missense	probably benign	0.00
R6179:Chd2	UTSW	7	73,094,071 (GRCm39)	missense	probably damaging	0.98
R6229:Chd2	UTSW	7	73,101,471 (GRCm39)	missense	possibly damaging	0.76
R6267:Chd2	UTSW	7	73,113,419 (GRCm39)	missense	probably damaging	0.99
R6310:Chd2	UTSW	7	73,102,912 (GRCm39)	missense	probably damaging	1.00
R6439:Chd2	UTSW	7	73,130,154 (GRCm39)	missense	probably damaging	1.00
R6444:Chd2	UTSW	7	73,150,785 (GRCm39)	critical splice acceptor site	probably null
R6529:Chd2	UTSW	7	73,153,191 (GRCm39)	missense	possibly damaging	0.89
R6611:Chd2	UTSW	7	73,143,313 (GRCm39)	missense	probably damaging	0.99
R6661:Chd2	UTSW	7	73,140,230 (GRCm39)	missense	possibly damaging	0.95
R6782:Chd2	UTSW	7	73,125,127 (GRCm39)	nonsense	probably null
R6860:Chd2	UTSW	7	73,147,558 (GRCm39)	missense	possibly damaging	0.95
R6955:Chd2	UTSW	7	73,125,171 (GRCm39)	missense	probably damaging	1.00
R6984:Chd2	UTSW	7	73,134,159 (GRCm39)	nonsense	probably null
R7095:Chd2	UTSW	7	73,121,629 (GRCm39)	missense	probably damaging	1.00
R7121:Chd2	UTSW	7	73,119,418 (GRCm39)	missense	probably benign	0.00
R7179:Chd2	UTSW	7	73,125,168 (GRCm39)	missense	probably damaging	1.00
R7500:Chd2	UTSW	7	73,101,556 (GRCm39)	missense	probably damaging	1.00
R7615:Chd2	UTSW	7	73,091,390 (GRCm39)	missense	probably damaging	0.97
R7646:Chd2	UTSW	7	73,085,521 (GRCm39)	missense	possibly damaging	0.49
R7764:Chd2	UTSW	7	73,121,567 (GRCm39)	missense	probably null	1.00
R7898:Chd2	UTSW	7	73,169,223 (GRCm39)	critical splice donor site	probably null
R7935:Chd2	UTSW	7	73,149,373 (GRCm39)	missense	probably benign	0.01
R8033:Chd2	UTSW	7	73,085,628 (GRCm39)	missense	probably damaging	1.00
R8070:Chd2	UTSW	7	73,101,506 (GRCm39)	missense	probably benign
R8071:Chd2	UTSW	7	73,187,132 (GRCm39)	missense	probably benign
R8188:Chd2	UTSW	7	73,079,504 (GRCm39)	nonsense	probably null
R8196:Chd2	UTSW	7	73,118,285 (GRCm39)	missense	probably benign	0.00
R8258:Chd2	UTSW	7	73,085,532 (GRCm39)	missense	probably benign	0.11
R8259:Chd2	UTSW	7	73,085,532 (GRCm39)	missense	probably benign	0.11
R8357:Chd2	UTSW	7	73,096,985 (GRCm39)	missense	probably damaging	0.99
R8457:Chd2	UTSW	7	73,096,985 (GRCm39)	missense	probably damaging	0.99
R8778:Chd2	UTSW	7	73,079,483 (GRCm39)	missense	possibly damaging	0.88
R8816:Chd2	UTSW	7	73,140,245 (GRCm39)	missense	probably damaging	1.00
R8875:Chd2	UTSW	7	73,151,783 (GRCm39)	missense	probably damaging	1.00
R8935:Chd2	UTSW	7	73,153,210 (GRCm39)	missense	possibly damaging	0.47
R9005:Chd2	UTSW	7	73,134,294 (GRCm39)	missense	probably damaging	0.98
R9009:Chd2	UTSW	7	73,143,192 (GRCm39)	missense	probably benign	0.39
R9009:Chd2	UTSW	7	73,140,402 (GRCm39)	missense	probably benign	0.12
R9021:Chd2	UTSW	7	73,091,393 (GRCm39)	missense	probably benign	0.03
R9038:Chd2	UTSW	7	73,105,358 (GRCm39)	missense	probably damaging	1.00
R9064:Chd2	UTSW	7	73,143,279 (GRCm39)	missense	possibly damaging	0.70
R9383:Chd2	UTSW	7	73,098,918 (GRCm39)	missense	probably null	1.00
R9501:Chd2	UTSW	7	73,130,294 (GRCm39)	missense	probably damaging	1.00
R9501:Chd2	UTSW	7	73,091,481 (GRCm39)	missense	possibly damaging	0.92
R9550:Chd2	UTSW	7	73,119,439 (GRCm39)	missense	probably damaging	0.99
R9583:Chd2	UTSW	7	73,130,230 (GRCm39)	missense	probably damaging	0.99
R9665:Chd2	UTSW	7	73,079,555 (GRCm39)	missense	probably benign	0.00
RF009:Chd2	UTSW	7	73,169,410 (GRCm39)	missense	possibly damaging	0.73
X0025:Chd2	UTSW	7	73,157,585 (GRCm39)	missense	probably benign	0.11
Z1177:Chd2	UTSW	7	73,118,334 (GRCm39)	missense	possibly damaging	0.48

Predicted Primers

PCR Primer
(F):5'- AGACCAAGTCTGGAAACCCTG -3'
(R):5'- TGGGAAGTCTGAGCACCAAC -3'

Sequencing Primer
(F):5'- GTCTGGAAACCCTGCAGGAAC -3'
(R):5'- GCCCCAGACTTGACACTTG -3'

Posted On

2015-03-18