Mutagenetix > Incidental Mutation

Incidental Mutation 'R6444:Chd2'

519130

Institutional Source

Beutler Lab

Gene Symbol

Chd2

Ensembl Gene

ENSMUSG00000078671

Gene Name

chromodomain helicase DNA binding protein 2

Synonyms

5630401D06Rik, 2810013C04Rik, 2810040A01Rik

MMRRC Submission

044582-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.613) question?

Stock #

R6444 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

73076400-73191494 bp(-) (GRCm39)

Type of Mutation

critical splice acceptor site

DNA Base Change (assembly)

T to C at 73150785 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000142848 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000026895] [ENSMUST00000026895] [ENSMUST00000026895] [ENSMUST00000169922] [ENSMUST00000169922] [ENSMUST00000169922] [ENSMUST00000199601] [ENSMUST00000199641] [ENSMUST00000199641] [ENSMUST00000199641]

AlphaFold

E9PZM4

Predicted Effect

probably null
Transcript: ENSMUST00000026895

SMART Domains

Protein: ENSMUSP00000026895
Gene: ENSMUSG00000078671

Domain	Start	End	E-Value	Type
low complexity region	13	75	N/A	INTRINSIC
low complexity region	80	91	N/A	INTRINSIC
low complexity region	126	136	N/A	INTRINSIC
low complexity region	146	160	N/A	INTRINSIC
low complexity region	199	208	N/A	INTRINSIC
CHROMO	224	310	2.3e-21	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000026895

SMART Domains

Protein: ENSMUSP00000026895
Gene: ENSMUSG00000078671

Domain	Start	End	E-Value	Type
low complexity region	13	75	N/A	INTRINSIC
low complexity region	80	91	N/A	INTRINSIC
low complexity region	126	136	N/A	INTRINSIC
low complexity region	146	160	N/A	INTRINSIC
low complexity region	199	208	N/A	INTRINSIC
CHROMO	224	310	2.3e-21	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000026895

SMART Domains

Protein: ENSMUSP00000026895
Gene: ENSMUSG00000078671

Domain	Start	End	E-Value	Type
low complexity region	13	75	N/A	INTRINSIC
low complexity region	80	91	N/A	INTRINSIC
low complexity region	126	136	N/A	INTRINSIC
low complexity region	146	160	N/A	INTRINSIC
low complexity region	199	208	N/A	INTRINSIC
CHROMO	224	310	2.3e-21	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000169922

SMART Domains

Protein: ENSMUSP00000126352
Gene: ENSMUSG00000078671

Domain	Start	End	E-Value	Type
low complexity region	13	75	N/A	INTRINSIC
low complexity region	80	91	N/A	INTRINSIC
low complexity region	126	136	N/A	INTRINSIC
low complexity region	176	196	N/A	INTRINSIC
low complexity region	235	244	N/A	INTRINSIC
CHROMO	260	346	3.64e-19	SMART
CHROMO	376	449	7.99e-16	SMART
DEXDc	480	677	1.93e-37	SMART
Blast:DEXDc	678	729	2e-18	BLAST
low complexity region	793	806	N/A	INTRINSIC
HELICc	821	905	1.2e-24	SMART
Blast:DEXDc	960	1244	4e-63	BLAST
PDB:4B4C\|A	1128	1316	5e-78	PDB
low complexity region	1317	1329	N/A	INTRINSIC
low complexity region	1338	1351	N/A	INTRINSIC
low complexity region	1389	1403	N/A	INTRINSIC
low complexity region	1407	1441	N/A	INTRINSIC
DUF4208	1451	1555	1.85e-52	SMART
low complexity region	1557	1572	N/A	INTRINSIC
low complexity region	1704	1729	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000169922

SMART Domains

Protein: ENSMUSP00000126352
Gene: ENSMUSG00000078671

Domain	Start	End	E-Value	Type
low complexity region	13	75	N/A	INTRINSIC
low complexity region	80	91	N/A	INTRINSIC
low complexity region	126	136	N/A	INTRINSIC
low complexity region	176	196	N/A	INTRINSIC
low complexity region	235	244	N/A	INTRINSIC
CHROMO	260	346	3.64e-19	SMART
CHROMO	376	449	7.99e-16	SMART
DEXDc	480	677	1.93e-37	SMART
Blast:DEXDc	678	729	2e-18	BLAST
low complexity region	793	806	N/A	INTRINSIC
HELICc	821	905	1.2e-24	SMART
Blast:DEXDc	960	1244	4e-63	BLAST
PDB:4B4C\|A	1128	1316	5e-78	PDB
low complexity region	1317	1329	N/A	INTRINSIC
low complexity region	1338	1351	N/A	INTRINSIC
low complexity region	1389	1403	N/A	INTRINSIC
low complexity region	1407	1441	N/A	INTRINSIC
DUF4208	1451	1555	1.85e-52	SMART
low complexity region	1557	1572	N/A	INTRINSIC
low complexity region	1704	1729	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000169922

SMART Domains

Protein: ENSMUSP00000126352
Gene: ENSMUSG00000078671

Domain	Start	End	E-Value	Type
low complexity region	13	75	N/A	INTRINSIC
low complexity region	80	91	N/A	INTRINSIC
low complexity region	126	136	N/A	INTRINSIC
low complexity region	176	196	N/A	INTRINSIC
low complexity region	235	244	N/A	INTRINSIC
CHROMO	260	346	3.64e-19	SMART
CHROMO	376	449	7.99e-16	SMART
DEXDc	480	677	1.93e-37	SMART
Blast:DEXDc	678	729	2e-18	BLAST
low complexity region	793	806	N/A	INTRINSIC
HELICc	821	905	1.2e-24	SMART
Blast:DEXDc	960	1244	4e-63	BLAST
PDB:4B4C\|A	1128	1316	5e-78	PDB
low complexity region	1317	1329	N/A	INTRINSIC
low complexity region	1338	1351	N/A	INTRINSIC
low complexity region	1389	1403	N/A	INTRINSIC
low complexity region	1407	1441	N/A	INTRINSIC
DUF4208	1451	1555	1.85e-52	SMART
low complexity region	1557	1572	N/A	INTRINSIC
low complexity region	1704	1729	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000199601

SMART Domains

Protein: ENSMUSP00000143203
Gene: ENSMUSG00000078671

Domain	Start	End	E-Value	Type
CHROMO	2	65	8.1e-14	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000199641

SMART Domains

Protein: ENSMUSP00000142848
Gene: ENSMUSG00000078671

Domain	Start	End	E-Value	Type
CHROMO	1	38	1.2e-2	SMART
CHROMO	68	119	1.6e-10	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000199641

SMART Domains

Protein: ENSMUSP00000142848
Gene: ENSMUSG00000078671

Domain	Start	End	E-Value	Type
CHROMO	1	38	1.2e-2	SMART
CHROMO	68	119	1.6e-10	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000199641

SMART Domains

Protein: ENSMUSP00000142848
Gene: ENSMUSG00000078671

Domain	Start	End	E-Value	Type
CHROMO	1	38	1.2e-2	SMART
CHROMO	68	119	1.6e-10	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000205458

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000206665

Meta Mutation Damage Score

0.9592

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.1%
20x: 94.4%

Validation Efficiency

100% (37/37)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The CHD family of proteins is characterized by the presence of chromo (chromatin organization modifier) domains and SNF2-related helicase/ATPase domains. CHD genes alter gene expression possibly by modification of chromatin structure thus altering access of the transcriptional apparatus to its chromosomal DNA template. Alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit early postnatal lethality associated with fetal growth retardation. Mice heterozygous for a gene trap allele exhibit postnatal lethality and premature death after weaning associated with growth retardation and multi-organ defects. [provided by MGI curators]

Allele List at MGI

All alleles(169) : Targeted, knock-out(1) Gene trapped(168)

Other mutations in this stock

Total: 36 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A430033K04Rik	ACAGAGCAGTGCCTACCAG	ACAG	5: 138,637,831 (GRCm39)		probably benign	Het
Bcas2	T	A	3: 103,079,362 (GRCm39)		probably null	Het
Camk1d	A	T	2: 5,317,956 (GRCm39)	I233N	probably damaging	Het
Cnot2	T	C	10: 116,335,260 (GRCm39)	D246G	probably benign	Het
Cped1	A	C	6: 21,986,930 (GRCm39)	I41L	probably benign	Het
Dcdc2c	A	G	12: 28,585,475 (GRCm39)	V174A	probably damaging	Het
Dscam	G	A	16: 96,420,844 (GRCm39)	R1681C	probably damaging	Het
Dysf	G	A	6: 84,167,822 (GRCm39)	V1755M	probably benign	Het
Eif5b	G	A	1: 38,075,292 (GRCm39)	D590N	probably damaging	Het
Fntb	A	G	12: 76,963,214 (GRCm39)	Y399C	probably damaging	Het
Galns	T	C	8: 123,338,077 (GRCm39)	M1V	probably null	Het
Galnt15	T	C	14: 31,762,368 (GRCm39)	F199L	probably damaging	Het
Gm8229	A	T	14: 44,602,928 (GRCm39)	H38L	unknown	Het
Magel2	T	C	7: 62,029,747 (GRCm39)	Y884H	unknown	Het
Miga1	A	T	3: 151,989,468 (GRCm39)	V473E	probably damaging	Het
Mrgprx1	C	T	7: 47,671,562 (GRCm39)	V62I	possibly damaging	Het
Mybl1	G	A	1: 9,755,917 (GRCm39)	P211S	possibly damaging	Het
Myo19	A	G	11: 84,786,134 (GRCm39)	H254R	probably benign	Het
Myo1h	A	G	5: 114,453,017 (GRCm39)	T6A	possibly damaging	Het
Ncbp2	CGTCTGGATG	CG	16: 31,775,161 (GRCm39)		probably null	Het
Or5b119	A	T	19: 13,456,794 (GRCm39)	M256K	possibly damaging	Het
Or8g20	T	C	9: 39,395,614 (GRCm39)	T309A	probably benign	Het
Psmd12	A	G	11: 107,377,280 (GRCm39)	E113G	possibly damaging	Het
Ptpn3	T	C	4: 57,195,730 (GRCm39)	D879G	possibly damaging	Het
Rufy3	A	G	5: 88,785,166 (GRCm39)	Q414R	probably damaging	Het
Slc14a2	A	G	18: 78,197,317 (GRCm39)	I813T	probably damaging	Het
Smok2a	G	T	17: 13,444,500 (GRCm39)	A26S	probably benign	Het
Spsb3	T	A	17: 25,110,550 (GRCm39)	L459Q	probably damaging	Het
Tacc2	T	C	7: 130,225,142 (GRCm39)	V609A	possibly damaging	Het
Tmem185b	C	A	1: 119,454,365 (GRCm39)	A42E	probably damaging	Het
Trim56	A	G	5: 137,141,470 (GRCm39)	V682A	probably damaging	Het
Trim75	T	C	8: 65,435,488 (GRCm39)	K321E	possibly damaging	Het
Ttc17	A	C	2: 94,133,891 (GRCm39)	M1098R	possibly damaging	Het
Ydjc	C	A	16: 16,965,545 (GRCm39)	H136Q	probably damaging	Het
Zfp568	A	T	7: 29,716,682 (GRCm39)	H193L	probably benign	Het
Znhit1	A	G	5: 137,011,254 (GRCm39)	V153A	probably benign	Het

Other mutations in Chd2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00232:Chd2	APN	7	73,118,325 (GRCm39)	missense	probably damaging	0.99
IGL00535:Chd2	APN	7	73,190,576 (GRCm39)	missense	probably benign	0.01
IGL00961:Chd2	APN	7	73,093,997 (GRCm39)	missense	probably damaging	0.99
IGL01092:Chd2	APN	7	73,091,434 (GRCm39)	missense	possibly damaging	0.69
IGL02035:Chd2	APN	7	73,091,375 (GRCm39)	splice site	probably null
IGL02083:Chd2	APN	7	73,130,816 (GRCm39)	missense	possibly damaging	0.95
IGL02205:Chd2	APN	7	73,091,465 (GRCm39)	missense	probably benign	0.01
IGL02243:Chd2	APN	7	73,147,456 (GRCm39)	splice site	probably null
IGL02385:Chd2	APN	7	73,085,570 (GRCm39)	missense	probably damaging	1.00
IGL02552:Chd2	APN	7	73,097,068 (GRCm39)	unclassified	probably benign
IGL02590:Chd2	APN	7	73,102,948 (GRCm39)	missense	probably benign	0.00
IGL02684:Chd2	APN	7	73,125,097 (GRCm39)	missense	probably damaging	0.99
IGL02731:Chd2	APN	7	73,143,204 (GRCm39)	missense	probably damaging	0.99
IGL03272:Chd2	APN	7	73,102,914 (GRCm39)	missense	possibly damaging	0.94
1mM(1):Chd2	UTSW	7	73,151,852 (GRCm39)	missense	possibly damaging	0.65
A4554:Chd2	UTSW	7	73,130,716 (GRCm39)	missense	probably benign
F6893:Chd2	UTSW	7	73,157,620 (GRCm39)	missense	possibly damaging	0.92
R0012:Chd2	UTSW	7	73,105,267 (GRCm39)	missense	probably damaging	1.00
R0012:Chd2	UTSW	7	73,105,267 (GRCm39)	missense	probably damaging	1.00
R0068:Chd2	UTSW	7	73,134,282 (GRCm39)	missense	probably damaging	1.00
R0763:Chd2	UTSW	7	73,097,022 (GRCm39)	missense	possibly damaging	0.74
R0973:Chd2	UTSW	7	73,128,412 (GRCm39)	missense	probably damaging	1.00
R0973:Chd2	UTSW	7	73,128,412 (GRCm39)	missense	probably damaging	1.00
R0974:Chd2	UTSW	7	73,128,412 (GRCm39)	missense	probably damaging	1.00
R1223:Chd2	UTSW	7	73,134,265 (GRCm39)	missense	probably damaging	1.00
R1435:Chd2	UTSW	7	73,102,884 (GRCm39)	missense	probably damaging	0.99
R1527:Chd2	UTSW	7	73,140,362 (GRCm39)	nonsense	probably null
R1599:Chd2	UTSW	7	73,122,799 (GRCm39)	missense	probably benign	0.05
R1657:Chd2	UTSW	7	73,130,178 (GRCm39)	missense	probably damaging	1.00
R1932:Chd2	UTSW	7	73,104,193 (GRCm39)	missense	probably damaging	0.99
R2110:Chd2	UTSW	7	73,079,735 (GRCm39)	missense	probably benign	0.00
R2202:Chd2	UTSW	7	73,128,416 (GRCm39)	missense	probably benign	0.00
R2383:Chd2	UTSW	7	73,153,168 (GRCm39)	missense	possibly damaging	0.89
R2393:Chd2	UTSW	7	73,157,631 (GRCm39)	missense	possibly damaging	0.92
R3699:Chd2	UTSW	7	73,118,238 (GRCm39)	missense	probably benign	0.35
R3713:Chd2	UTSW	7	73,121,538 (GRCm39)	unclassified	probably benign
R3788:Chd2	UTSW	7	73,096,878 (GRCm39)	unclassified	probably benign
R3826:Chd2	UTSW	7	73,141,163 (GRCm39)	missense	possibly damaging	0.71
R3828:Chd2	UTSW	7	73,141,163 (GRCm39)	missense	possibly damaging	0.71
R3830:Chd2	UTSW	7	73,141,163 (GRCm39)	missense	possibly damaging	0.71
R3966:Chd2	UTSW	7	73,114,143 (GRCm39)	splice site	probably benign
R4093:Chd2	UTSW	7	73,150,764 (GRCm39)	missense	possibly damaging	0.70
R4431:Chd2	UTSW	7	73,085,709 (GRCm39)	missense	possibly damaging	0.56
R4461:Chd2	UTSW	7	73,190,622 (GRCm39)	intron	probably benign
R4782:Chd2	UTSW	7	73,134,184 (GRCm39)	missense	possibly damaging	0.80
R4791:Chd2	UTSW	7	73,118,325 (GRCm39)	missense	probably benign	0.13
R4792:Chd2	UTSW	7	73,118,325 (GRCm39)	missense	probably benign	0.13
R4799:Chd2	UTSW	7	73,134,184 (GRCm39)	missense	possibly damaging	0.80
R4832:Chd2	UTSW	7	73,151,873 (GRCm39)	missense	probably damaging	1.00
R5055:Chd2	UTSW	7	73,130,256 (GRCm39)	missense	probably damaging	1.00
R5071:Chd2	UTSW	7	73,079,437 (GRCm39)	missense	probably benign	0.03
R5328:Chd2	UTSW	7	73,113,429 (GRCm39)	missense	possibly damaging	0.96
R5444:Chd2	UTSW	7	73,122,833 (GRCm39)	missense	probably damaging	1.00
R5643:Chd2	UTSW	7	73,134,232 (GRCm39)	missense	probably damaging	1.00
R5666:Chd2	UTSW	7	73,091,465 (GRCm39)	missense	probably benign	0.01
R5670:Chd2	UTSW	7	73,091,465 (GRCm39)	missense	probably benign	0.01
R5706:Chd2	UTSW	7	73,141,105 (GRCm39)	missense	possibly damaging	0.74
R5825:Chd2	UTSW	7	73,134,350 (GRCm39)	splice site	probably null
R5834:Chd2	UTSW	7	73,128,463 (GRCm39)	missense	probably damaging	1.00
R5920:Chd2	UTSW	7	73,187,060 (GRCm39)	missense	probably damaging	0.97
R6051:Chd2	UTSW	7	73,085,590 (GRCm39)	missense	probably benign	0.00
R6179:Chd2	UTSW	7	73,094,071 (GRCm39)	missense	probably damaging	0.98
R6229:Chd2	UTSW	7	73,101,471 (GRCm39)	missense	possibly damaging	0.76
R6267:Chd2	UTSW	7	73,113,419 (GRCm39)	missense	probably damaging	0.99
R6310:Chd2	UTSW	7	73,102,912 (GRCm39)	missense	probably damaging	1.00
R6439:Chd2	UTSW	7	73,130,154 (GRCm39)	missense	probably damaging	1.00
R6529:Chd2	UTSW	7	73,153,191 (GRCm39)	missense	possibly damaging	0.89
R6611:Chd2	UTSW	7	73,143,313 (GRCm39)	missense	probably damaging	0.99
R6661:Chd2	UTSW	7	73,140,230 (GRCm39)	missense	possibly damaging	0.95
R6782:Chd2	UTSW	7	73,125,127 (GRCm39)	nonsense	probably null
R6860:Chd2	UTSW	7	73,147,558 (GRCm39)	missense	possibly damaging	0.95
R6955:Chd2	UTSW	7	73,125,171 (GRCm39)	missense	probably damaging	1.00
R6984:Chd2	UTSW	7	73,134,159 (GRCm39)	nonsense	probably null
R7095:Chd2	UTSW	7	73,121,629 (GRCm39)	missense	probably damaging	1.00
R7121:Chd2	UTSW	7	73,119,418 (GRCm39)	missense	probably benign	0.00
R7179:Chd2	UTSW	7	73,125,168 (GRCm39)	missense	probably damaging	1.00
R7500:Chd2	UTSW	7	73,101,556 (GRCm39)	missense	probably damaging	1.00
R7615:Chd2	UTSW	7	73,091,390 (GRCm39)	missense	probably damaging	0.97
R7646:Chd2	UTSW	7	73,085,521 (GRCm39)	missense	possibly damaging	0.49
R7764:Chd2	UTSW	7	73,121,567 (GRCm39)	missense	probably null	1.00
R7898:Chd2	UTSW	7	73,169,223 (GRCm39)	critical splice donor site	probably null
R7935:Chd2	UTSW	7	73,149,373 (GRCm39)	missense	probably benign	0.01
R8033:Chd2	UTSW	7	73,085,628 (GRCm39)	missense	probably damaging	1.00
R8070:Chd2	UTSW	7	73,101,506 (GRCm39)	missense	probably benign
R8071:Chd2	UTSW	7	73,187,132 (GRCm39)	missense	probably benign
R8188:Chd2	UTSW	7	73,079,504 (GRCm39)	nonsense	probably null
R8196:Chd2	UTSW	7	73,118,285 (GRCm39)	missense	probably benign	0.00
R8258:Chd2	UTSW	7	73,085,532 (GRCm39)	missense	probably benign	0.11
R8259:Chd2	UTSW	7	73,085,532 (GRCm39)	missense	probably benign	0.11
R8357:Chd2	UTSW	7	73,096,985 (GRCm39)	missense	probably damaging	0.99
R8457:Chd2	UTSW	7	73,096,985 (GRCm39)	missense	probably damaging	0.99
R8778:Chd2	UTSW	7	73,079,483 (GRCm39)	missense	possibly damaging	0.88
R8816:Chd2	UTSW	7	73,140,245 (GRCm39)	missense	probably damaging	1.00
R8875:Chd2	UTSW	7	73,151,783 (GRCm39)	missense	probably damaging	1.00
R8935:Chd2	UTSW	7	73,153,210 (GRCm39)	missense	possibly damaging	0.47
R9005:Chd2	UTSW	7	73,134,294 (GRCm39)	missense	probably damaging	0.98
R9009:Chd2	UTSW	7	73,143,192 (GRCm39)	missense	probably benign	0.39
R9009:Chd2	UTSW	7	73,140,402 (GRCm39)	missense	probably benign	0.12
R9021:Chd2	UTSW	7	73,091,393 (GRCm39)	missense	probably benign	0.03
R9038:Chd2	UTSW	7	73,105,358 (GRCm39)	missense	probably damaging	1.00
R9064:Chd2	UTSW	7	73,143,279 (GRCm39)	missense	possibly damaging	0.70
R9383:Chd2	UTSW	7	73,098,918 (GRCm39)	missense	probably null	1.00
R9501:Chd2	UTSW	7	73,130,294 (GRCm39)	missense	probably damaging	1.00
R9501:Chd2	UTSW	7	73,091,481 (GRCm39)	missense	possibly damaging	0.92
R9550:Chd2	UTSW	7	73,119,439 (GRCm39)	missense	probably damaging	0.99
R9583:Chd2	UTSW	7	73,130,230 (GRCm39)	missense	probably damaging	0.99
R9665:Chd2	UTSW	7	73,079,555 (GRCm39)	missense	probably benign	0.00
RF009:Chd2	UTSW	7	73,169,410 (GRCm39)	missense	possibly damaging	0.73
X0025:Chd2	UTSW	7	73,157,585 (GRCm39)	missense	probably benign	0.11
Z1177:Chd2	UTSW	7	73,118,334 (GRCm39)	missense	possibly damaging	0.48

Predicted Primers

PCR Primer
(F):5'- TGCAGCCCTCAAATAATGCTTG -3'
(R):5'- GCAGAGCCAATGTCAAGAAC -3'

Sequencing Primer
(F):5'- GGAAACCTTGGAACCAATATCCTTG -3'
(R):5'- AGTCTGGGGTGACTTCTGTG -3'

Posted On

2018-05-24