Incidental Mutation 'R6444:Chd2'
ID 519130
Institutional Source Beutler Lab
Gene Symbol Chd2
Ensembl Gene ENSMUSG00000078671
Gene Name chromodomain helicase DNA binding protein 2
Synonyms 2810040A01Rik, 2810013C04Rik, 5630401D06Rik
MMRRC Submission
Accession Numbers

Genbank: NM_001081345; Ensembl: ENSMUST00000169922; MGI: 2448567

Is this an essential gene? Possibly essential (E-score: 0.600) question?
Stock # R6444 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 73426638-73541830 bp(-) (GRCm38)
Type of Mutation critical splice acceptor site
DNA Base Change (assembly) T to C at 73501037 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000142848 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026895] [ENSMUST00000026895] [ENSMUST00000026895] [ENSMUST00000169922] [ENSMUST00000169922] [ENSMUST00000169922] [ENSMUST00000199601] [ENSMUST00000199641] [ENSMUST00000199641] [ENSMUST00000199641]
AlphaFold E9PZM4
Predicted Effect probably null
Transcript: ENSMUST00000026895
SMART Domains Protein: ENSMUSP00000026895
Gene: ENSMUSG00000078671

DomainStartEndE-ValueType
low complexity region 13 75 N/A INTRINSIC
low complexity region 80 91 N/A INTRINSIC
low complexity region 126 136 N/A INTRINSIC
low complexity region 146 160 N/A INTRINSIC
low complexity region 199 208 N/A INTRINSIC
CHROMO 224 310 2.3e-21 SMART
Predicted Effect probably null
Transcript: ENSMUST00000026895
SMART Domains Protein: ENSMUSP00000026895
Gene: ENSMUSG00000078671

DomainStartEndE-ValueType
low complexity region 13 75 N/A INTRINSIC
low complexity region 80 91 N/A INTRINSIC
low complexity region 126 136 N/A INTRINSIC
low complexity region 146 160 N/A INTRINSIC
low complexity region 199 208 N/A INTRINSIC
CHROMO 224 310 2.3e-21 SMART
Predicted Effect probably null
Transcript: ENSMUST00000026895
SMART Domains Protein: ENSMUSP00000026895
Gene: ENSMUSG00000078671

DomainStartEndE-ValueType
low complexity region 13 75 N/A INTRINSIC
low complexity region 80 91 N/A INTRINSIC
low complexity region 126 136 N/A INTRINSIC
low complexity region 146 160 N/A INTRINSIC
low complexity region 199 208 N/A INTRINSIC
CHROMO 224 310 2.3e-21 SMART
Predicted Effect probably null
Transcript: ENSMUST00000169922
SMART Domains Protein: ENSMUSP00000126352
Gene: ENSMUSG00000078671

DomainStartEndE-ValueType
low complexity region 13 75 N/A INTRINSIC
low complexity region 80 91 N/A INTRINSIC
low complexity region 126 136 N/A INTRINSIC
low complexity region 176 196 N/A INTRINSIC
low complexity region 235 244 N/A INTRINSIC
CHROMO 260 346 3.64e-19 SMART
CHROMO 376 449 7.99e-16 SMART
DEXDc 480 677 1.93e-37 SMART
Blast:DEXDc 678 729 2e-18 BLAST
low complexity region 793 806 N/A INTRINSIC
HELICc 821 905 1.2e-24 SMART
Blast:DEXDc 960 1244 4e-63 BLAST
PDB:4B4C|A 1128 1316 5e-78 PDB
low complexity region 1317 1329 N/A INTRINSIC
low complexity region 1338 1351 N/A INTRINSIC
low complexity region 1389 1403 N/A INTRINSIC
low complexity region 1407 1441 N/A INTRINSIC
DUF4208 1451 1555 1.85e-52 SMART
low complexity region 1557 1572 N/A INTRINSIC
low complexity region 1704 1729 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000169922
SMART Domains Protein: ENSMUSP00000126352
Gene: ENSMUSG00000078671

DomainStartEndE-ValueType
low complexity region 13 75 N/A INTRINSIC
low complexity region 80 91 N/A INTRINSIC
low complexity region 126 136 N/A INTRINSIC
low complexity region 176 196 N/A INTRINSIC
low complexity region 235 244 N/A INTRINSIC
CHROMO 260 346 3.64e-19 SMART
CHROMO 376 449 7.99e-16 SMART
DEXDc 480 677 1.93e-37 SMART
Blast:DEXDc 678 729 2e-18 BLAST
low complexity region 793 806 N/A INTRINSIC
HELICc 821 905 1.2e-24 SMART
Blast:DEXDc 960 1244 4e-63 BLAST
PDB:4B4C|A 1128 1316 5e-78 PDB
low complexity region 1317 1329 N/A INTRINSIC
low complexity region 1338 1351 N/A INTRINSIC
low complexity region 1389 1403 N/A INTRINSIC
low complexity region 1407 1441 N/A INTRINSIC
DUF4208 1451 1555 1.85e-52 SMART
low complexity region 1557 1572 N/A INTRINSIC
low complexity region 1704 1729 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000169922
SMART Domains Protein: ENSMUSP00000126352
Gene: ENSMUSG00000078671

DomainStartEndE-ValueType
low complexity region 13 75 N/A INTRINSIC
low complexity region 80 91 N/A INTRINSIC
low complexity region 126 136 N/A INTRINSIC
low complexity region 176 196 N/A INTRINSIC
low complexity region 235 244 N/A INTRINSIC
CHROMO 260 346 3.64e-19 SMART
CHROMO 376 449 7.99e-16 SMART
DEXDc 480 677 1.93e-37 SMART
Blast:DEXDc 678 729 2e-18 BLAST
low complexity region 793 806 N/A INTRINSIC
HELICc 821 905 1.2e-24 SMART
Blast:DEXDc 960 1244 4e-63 BLAST
PDB:4B4C|A 1128 1316 5e-78 PDB
low complexity region 1317 1329 N/A INTRINSIC
low complexity region 1338 1351 N/A INTRINSIC
low complexity region 1389 1403 N/A INTRINSIC
low complexity region 1407 1441 N/A INTRINSIC
DUF4208 1451 1555 1.85e-52 SMART
low complexity region 1557 1572 N/A INTRINSIC
low complexity region 1704 1729 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000199601
SMART Domains Protein: ENSMUSP00000143203
Gene: ENSMUSG00000078671

DomainStartEndE-ValueType
CHROMO 2 65 8.1e-14 SMART
Predicted Effect probably null
Transcript: ENSMUST00000199641
SMART Domains Protein: ENSMUSP00000142848
Gene: ENSMUSG00000078671

DomainStartEndE-ValueType
CHROMO 1 38 1.2e-2 SMART
CHROMO 68 119 1.6e-10 SMART
Predicted Effect probably null
Transcript: ENSMUST00000199641
SMART Domains Protein: ENSMUSP00000142848
Gene: ENSMUSG00000078671

DomainStartEndE-ValueType
CHROMO 1 38 1.2e-2 SMART
CHROMO 68 119 1.6e-10 SMART
Predicted Effect probably null
Transcript: ENSMUST00000199641
SMART Domains Protein: ENSMUSP00000142848
Gene: ENSMUSG00000078671

DomainStartEndE-ValueType
CHROMO 1 38 1.2e-2 SMART
CHROMO 68 119 1.6e-10 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205458
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206665
Meta Mutation Damage Score 0.9592 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.4%
Validation Efficiency 100% (37/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The CHD family of proteins is characterized by the presence of chromo (chromatin organization modifier) domains and SNF2-related helicase/ATPase domains. CHD genes alter gene expression possibly by modification of chromatin structure thus altering access of the transcriptional apparatus to its chromosomal DNA template. Alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit early postnatal lethality associated with fetal growth retardation. Mice heterozygous for a gene trap allele exhibit postnatal lethality and premature death after weaning associated with growth retardation and multi-organ defects. [provided by MGI curators]
Allele List at MGI

All alleles(169) : Targeted, knock-out(1) Gene trapped(168)

Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430033K04Rik ACAGAGCAGTGCCTACCAG ACAG 5: 138,639,569 probably benign Het
Bcas2 T A 3: 103,172,046 probably null Het
Camk1d A T 2: 5,313,145 I233N probably damaging Het
Cnot2 T C 10: 116,499,355 D246G probably benign Het
Cped1 A C 6: 21,986,931 I41L probably benign Het
Dcdc2c A G 12: 28,535,476 V174A probably damaging Het
Dscam G A 16: 96,619,644 R1681C probably damaging Het
Dysf G A 6: 84,190,840 V1755M probably benign Het
Eif5b G A 1: 38,036,211 D590N probably damaging Het
Fntb A G 12: 76,916,440 Y399C probably damaging Het
Galns T C 8: 122,611,338 M1V probably null Het
Galnt15 T C 14: 32,040,411 F199L probably damaging Het
Gm8229 A T 14: 44,365,471 H38L unknown Het
Magel2 T C 7: 62,379,999 Y884H unknown Het
Miga1 A T 3: 152,283,831 V473E probably damaging Het
Mrgprx1 C T 7: 48,021,814 V62I possibly damaging Het
Mybl1 G A 1: 9,685,692 P211S possibly damaging Het
Myo19 A G 11: 84,895,308 H254R probably benign Het
Myo1h A G 5: 114,314,956 T6A possibly damaging Het
Ncbp2 CGTCTGGATG CG 16: 31,956,343 probably null Het
Olfr1475 A T 19: 13,479,430 M256K possibly damaging Het
Olfr44 T C 9: 39,484,318 T309A probably benign Het
Psmd12 A G 11: 107,486,454 E113G possibly damaging Het
Ptpn3 T C 4: 57,195,730 D879G possibly damaging Het
Rufy3 A G 5: 88,637,307 Q414R probably damaging Het
Slc14a2 A G 18: 78,154,102 I813T probably damaging Het
Smok2a G T 17: 13,225,613 A26S probably benign Het
Spsb3 T A 17: 24,891,576 L459Q probably damaging Het
Tacc2 T C 7: 130,623,412 V609A possibly damaging Het
Tmem185b C A 1: 119,526,635 A42E probably damaging Het
Trim56 A G 5: 137,112,616 V682A probably damaging Het
Trim75 T C 8: 64,982,836 K321E possibly damaging Het
Ttc17 A C 2: 94,303,546 M1098R possibly damaging Het
Ydjc C A 16: 17,147,681 H136Q probably damaging Het
Zfp568 A T 7: 30,017,257 H193L probably benign Het
Znhit1 A G 5: 136,982,400 V153A probably benign Het
Other mutations in Chd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00232:Chd2 APN 7 73468577 missense probably damaging 0.99
IGL00535:Chd2 APN 7 73540828 missense probably benign 0.01
IGL00961:Chd2 APN 7 73444249 missense probably damaging 0.99
IGL01092:Chd2 APN 7 73441686 missense possibly damaging 0.69
IGL02035:Chd2 APN 7 73441627 splice site probably null
IGL02083:Chd2 APN 7 73481068 missense possibly damaging 0.95
IGL02205:Chd2 APN 7 73441717 missense probably benign 0.01
IGL02243:Chd2 APN 7 73497708 splice site probably null
IGL02385:Chd2 APN 7 73435822 missense probably damaging 1.00
IGL02552:Chd2 APN 7 73447320 unclassified probably benign
IGL02590:Chd2 APN 7 73453200 missense probably benign 0.00
IGL02684:Chd2 APN 7 73475349 missense probably damaging 0.99
IGL02731:Chd2 APN 7 73493456 missense probably damaging 0.99
IGL03272:Chd2 APN 7 73453166 missense possibly damaging 0.94
1mM(1):Chd2 UTSW 7 73502104 missense possibly damaging 0.65
A4554:Chd2 UTSW 7 73480968 missense probably benign
F6893:Chd2 UTSW 7 73507872 missense possibly damaging 0.92
R0012:Chd2 UTSW 7 73455519 missense probably damaging 1.00
R0012:Chd2 UTSW 7 73455519 missense probably damaging 1.00
R0068:Chd2 UTSW 7 73484534 missense probably damaging 1.00
R0763:Chd2 UTSW 7 73447274 missense possibly damaging 0.74
R0973:Chd2 UTSW 7 73478664 missense probably damaging 1.00
R0973:Chd2 UTSW 7 73478664 missense probably damaging 1.00
R0974:Chd2 UTSW 7 73478664 missense probably damaging 1.00
R1223:Chd2 UTSW 7 73484517 missense probably damaging 1.00
R1435:Chd2 UTSW 7 73453136 missense probably damaging 0.99
R1527:Chd2 UTSW 7 73490614 nonsense probably null
R1599:Chd2 UTSW 7 73473051 missense probably benign 0.05
R1657:Chd2 UTSW 7 73480430 missense probably damaging 1.00
R1932:Chd2 UTSW 7 73454445 missense probably damaging 0.99
R2110:Chd2 UTSW 7 73429987 missense probably benign 0.00
R2202:Chd2 UTSW 7 73478668 missense probably benign 0.00
R2383:Chd2 UTSW 7 73503420 missense possibly damaging 0.89
R2393:Chd2 UTSW 7 73507883 missense possibly damaging 0.92
R3699:Chd2 UTSW 7 73468490 missense probably benign 0.35
R3713:Chd2 UTSW 7 73471790 unclassified probably benign
R3788:Chd2 UTSW 7 73447130 unclassified probably benign
R3826:Chd2 UTSW 7 73491415 missense possibly damaging 0.71
R3828:Chd2 UTSW 7 73491415 missense possibly damaging 0.71
R3830:Chd2 UTSW 7 73491415 missense possibly damaging 0.71
R3966:Chd2 UTSW 7 73464395 splice site probably benign
R4093:Chd2 UTSW 7 73501016 missense possibly damaging 0.70
R4431:Chd2 UTSW 7 73435961 missense possibly damaging 0.56
R4461:Chd2 UTSW 7 73540874 intron probably benign
R4782:Chd2 UTSW 7 73484436 missense possibly damaging 0.80
R4791:Chd2 UTSW 7 73468577 missense probably benign 0.13
R4792:Chd2 UTSW 7 73468577 missense probably benign 0.13
R4799:Chd2 UTSW 7 73484436 missense possibly damaging 0.80
R4832:Chd2 UTSW 7 73502125 missense probably damaging 1.00
R5055:Chd2 UTSW 7 73480508 missense probably damaging 1.00
R5071:Chd2 UTSW 7 73429689 missense probably benign 0.03
R5328:Chd2 UTSW 7 73463681 missense possibly damaging 0.96
R5444:Chd2 UTSW 7 73473085 missense probably damaging 1.00
R5643:Chd2 UTSW 7 73484484 missense probably damaging 1.00
R5666:Chd2 UTSW 7 73441717 missense probably benign 0.01
R5670:Chd2 UTSW 7 73441717 missense probably benign 0.01
R5706:Chd2 UTSW 7 73491357 missense possibly damaging 0.74
R5825:Chd2 UTSW 7 73484602 splice site probably null
R5834:Chd2 UTSW 7 73478715 missense probably damaging 1.00
R5920:Chd2 UTSW 7 73537312 missense probably damaging 0.97
R6051:Chd2 UTSW 7 73435842 missense probably benign 0.00
R6179:Chd2 UTSW 7 73444323 missense probably damaging 0.98
R6229:Chd2 UTSW 7 73451723 missense possibly damaging 0.76
R6267:Chd2 UTSW 7 73463671 missense probably damaging 0.99
R6310:Chd2 UTSW 7 73453164 missense probably damaging 1.00
R6439:Chd2 UTSW 7 73480406 missense probably damaging 1.00
R6529:Chd2 UTSW 7 73503443 missense possibly damaging 0.89
R6611:Chd2 UTSW 7 73493565 missense probably damaging 0.99
R6661:Chd2 UTSW 7 73490482 missense possibly damaging 0.95
R6782:Chd2 UTSW 7 73475379 nonsense probably null
R6860:Chd2 UTSW 7 73497810 missense possibly damaging 0.95
R6955:Chd2 UTSW 7 73475423 missense probably damaging 1.00
R6984:Chd2 UTSW 7 73484411 nonsense probably null
R7095:Chd2 UTSW 7 73471881 missense probably damaging 1.00
R7121:Chd2 UTSW 7 73469670 missense probably benign 0.00
R7179:Chd2 UTSW 7 73475420 missense probably damaging 1.00
R7500:Chd2 UTSW 7 73451808 missense probably damaging 1.00
R7615:Chd2 UTSW 7 73441642 missense probably damaging 0.97
R7646:Chd2 UTSW 7 73435773 missense possibly damaging 0.49
R7764:Chd2 UTSW 7 73471819 missense probably null 1.00
R7898:Chd2 UTSW 7 73519475 critical splice donor site probably null
R7935:Chd2 UTSW 7 73499625 missense probably benign 0.01
R8033:Chd2 UTSW 7 73435880 missense probably damaging 1.00
R8070:Chd2 UTSW 7 73451758 missense probably benign
R8071:Chd2 UTSW 7 73537384 missense probably benign
R8188:Chd2 UTSW 7 73429756 nonsense probably null
R8196:Chd2 UTSW 7 73468537 missense probably benign 0.00
R8258:Chd2 UTSW 7 73435784 missense probably benign 0.11
R8259:Chd2 UTSW 7 73435784 missense probably benign 0.11
R8357:Chd2 UTSW 7 73447237 missense probably damaging 0.99
R8457:Chd2 UTSW 7 73447237 missense probably damaging 0.99
R8778:Chd2 UTSW 7 73429735 missense possibly damaging 0.88
R8816:Chd2 UTSW 7 73490497 missense probably damaging 1.00
R8875:Chd2 UTSW 7 73502035 missense probably damaging 1.00
R8935:Chd2 UTSW 7 73503462 missense possibly damaging 0.47
R9005:Chd2 UTSW 7 73484546 missense probably damaging 0.98
R9009:Chd2 UTSW 7 73490654 missense probably benign 0.12
R9009:Chd2 UTSW 7 73493444 missense probably benign 0.39
R9021:Chd2 UTSW 7 73441645 missense probably benign 0.03
R9038:Chd2 UTSW 7 73455610 missense probably damaging 1.00
R9064:Chd2 UTSW 7 73493531 missense possibly damaging 0.70
R9383:Chd2 UTSW 7 73449170 missense probably null 1.00
R9501:Chd2 UTSW 7 73441733 missense possibly damaging 0.92
R9501:Chd2 UTSW 7 73480546 missense probably damaging 1.00
R9550:Chd2 UTSW 7 73469691 missense probably damaging 0.99
R9583:Chd2 UTSW 7 73480482 missense probably damaging 0.99
R9665:Chd2 UTSW 7 73429807 missense probably benign 0.00
RF009:Chd2 UTSW 7 73519662 missense possibly damaging 0.73
X0025:Chd2 UTSW 7 73507837 missense probably benign 0.11
Z1177:Chd2 UTSW 7 73468586 missense possibly damaging 0.48
Predicted Primers PCR Primer
(F):5'- TGCAGCCCTCAAATAATGCTTG -3'
(R):5'- GCAGAGCCAATGTCAAGAAC -3'

Sequencing Primer
(F):5'- GGAAACCTTGGAACCAATATCCTTG -3'
(R):5'- AGTCTGGGGTGACTTCTGTG -3'
Posted On 2018-05-24