Mutagenetix > Incidental Mutation

Incidental Mutation 'R3150:Mrc2'

271641

Institutional Source

Beutler Lab

Gene Symbol

Mrc2

Ensembl Gene

ENSMUSG00000020695

Gene Name

mannose receptor, C type 2

Synonyms

Endo180, uPARAP, novel lectin

MMRRC Submission

040602-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R3150 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

105183469-105241965 bp(+) (GRCm39)

Type of Mutation

splice site (5 bp from exon)

DNA Base Change (assembly)

G to A at 105239257 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000097909 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000021038] [ENSMUST00000100335]

AlphaFold

Q64449

Predicted Effect

probably benign
Transcript: ENSMUST00000021038

SMART Domains

Protein: ENSMUSP00000021038
Gene: ENSMUSG00000020695

Domain	Start	End	E-Value	Type
signal peptide	1	30	N/A	INTRINSIC
RICIN	40	160	8.49e-12	SMART
FN2	179	227	4.83e-27	SMART
CLECT	234	359	1.15e-33	SMART
CLECT	381	504	1.47e-40	SMART
CLECT	520	644	6.82e-27	SMART
CLECT	668	808	2.71e-30	SMART
CLECT	824	950	6.77e-31	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000100335

SMART Domains

Protein: ENSMUSP00000097909
Gene: ENSMUSG00000020695

Domain	Start	End	E-Value	Type
signal peptide	1	30	N/A	INTRINSIC
RICIN	40	160	8.49e-12	SMART
FN2	179	227	4.83e-27	SMART
CLECT	234	359	1.15e-33	SMART
CLECT	381	504	1.47e-40	SMART
CLECT	520	644	6.82e-27	SMART
CLECT	668	808	2.71e-30	SMART
CLECT	824	950	6.77e-31	SMART
CLECT	971	1107	3.91e-36	SMART
CLECT	1124	1243	1.04e-17	SMART
CLECT	1259	1392	9.08e-23	SMART
transmembrane domain	1412	1434	N/A	INTRINSIC

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the mannose receptor family of proteins that contain a fibronectin type II domain and multiple C-type lectin-like domains. The encoded protein plays a role in extracellular matrix remodeling by mediating the internalization and lysosomal degradation of collagen ligands. Expression of this gene may play a role in the tumorigenesis and metastasis of several malignancies including breast cancer, gliomas and metastatic bone disease. [provided by RefSeq, Feb 2012]
PHENOTYPE: Homozygous mice are visibly normal, viable and have no reproductive defects. Mouse embryonic fibroblasts derived from null mice exhibit decreased migration while bone marrow-derived macrophages exhibit increased migration. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 42 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Akna	A	T	4: 63,313,590 (GRCm39)	S178T	possibly damaging	Het
Cabin1	A	G	10: 75,492,745 (GRCm39)	L1850P	probably damaging	Het
Ccdc178	G	T	18: 22,200,709 (GRCm39)	A416E	possibly damaging	Het
Ces1g	C	T	8: 94,052,444 (GRCm39)	V282I	probably benign	Het
Col4a3	T	G	1: 82,634,858 (GRCm39)		probably null	Het
Crat	C	T	2: 30,303,871 (GRCm39)		probably null	Het
Csf2ra	C	A	19: 61,215,758 (GRCm39)	A16S	possibly damaging	Het
Cspg4b	A	T	13: 113,488,294 (GRCm39)	Q105H	probably damaging	Het
Cyp4f18	T	C	8: 72,747,044 (GRCm39)	D317G	possibly damaging	Het
Ddb1	T	A	19: 10,590,346 (GRCm39)	M291K	probably benign	Het
Fcgbpl1	C	A	7: 27,853,620 (GRCm39)	T1528N	probably benign	Het
Gfod2	C	T	8: 106,443,853 (GRCm39)	G230D	probably benign	Het
Git2	A	G	5: 114,868,410 (GRCm39)	S257P	probably damaging	Het
Gm5592	A	G	7: 40,937,804 (GRCm39)	E362G	probably benign	Het
Gpatch2l	A	G	12: 86,291,089 (GRCm39)	T91A	possibly damaging	Het
Hjurp	A	G	1: 88,194,283 (GRCm39)		probably benign	Het
Hnrnph1	T	A	11: 50,276,619 (GRCm39)	V439E	probably benign	Het
Itgad	C	A	7: 127,790,153 (GRCm39)	H651N	possibly damaging	Het
Map3k20	C	T	2: 72,202,336 (GRCm39)	T189M	probably damaging	Het
Mapk11	T	C	15: 89,029,653 (GRCm39)		probably null	Het
Nmral1	G	A	16: 4,534,333 (GRCm39)	T36I	probably damaging	Het
Or4c1	C	T	2: 89,133,562 (GRCm39)	V125M	possibly damaging	Het
Or5b119	A	G	19: 13,456,824 (GRCm39)	V246A	probably damaging	Het
Or7e169	A	G	9: 19,757,510 (GRCm39)	I135T	possibly damaging	Het
Padi6	A	G	4: 140,462,700 (GRCm39)	L307P	probably damaging	Het
Pkd1	G	T	17: 24,798,765 (GRCm39)	R2691L	probably benign	Het
Ppp2r2a	G	A	14: 67,261,214 (GRCm39)	R169W	probably damaging	Het
Prdm1	A	T	10: 44,334,488 (GRCm39)		probably null	Het
Robo1	C	T	16: 72,767,157 (GRCm39)	P443L	possibly damaging	Het
Rtn4	CGAGGAGGAGGAGGAGGA	CGAGGAGGAGGAGGA	11: 29,643,308 (GRCm39)		probably benign	Het
Shprh	A	G	10: 11,045,774 (GRCm39)	H865R	probably damaging	Het
Spats1	A	T	17: 45,775,480 (GRCm39)	S15T	probably damaging	Het
Srgap2	T	C	1: 131,220,327 (GRCm39)	T216A	probably benign	Het
Sry	ACTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG	ACTGCTGCTGCTGCTGCTGCTGCTGCTGCTG	Y: 2,662,944 (GRCm39)		probably benign	Het
Tie1	G	A	4: 118,333,022 (GRCm39)	A902V	probably damaging	Het
Usp22	T	C	11: 61,051,407 (GRCm39)	Q312R	probably damaging	Het
Vmn2r32	T	C	7: 7,475,554 (GRCm39)	Y443C	probably benign	Het
Vps13d	A	C	4: 144,813,360 (GRCm39)	D3274E	probably damaging	Het
Wdr62	A	T	7: 29,971,095 (GRCm39)	N167K	possibly damaging	Het
Xpo5	A	G	17: 46,553,173 (GRCm39)		probably null	Het
Zswim7	A	T	11: 62,164,611 (GRCm39)	I43N	possibly damaging	Het
Zswim9	T	C	7: 13,011,196 (GRCm39)	T51A	possibly damaging	Het

Other mutations in Mrc2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01105:Mrc2	APN	11	105,219,567 (GRCm39)	missense	probably damaging	0.96
IGL01374:Mrc2	APN	11	105,238,469 (GRCm39)	nonsense	probably null
IGL01751:Mrc2	APN	11	105,216,560 (GRCm39)	missense	probably benign	0.00
IGL01780:Mrc2	APN	11	105,216,547 (GRCm39)	missense	probably damaging	1.00
IGL01835:Mrc2	APN	11	105,227,503 (GRCm39)	missense	probably damaging	1.00
IGL02350:Mrc2	APN	11	105,216,547 (GRCm39)	missense	probably damaging	1.00
IGL02357:Mrc2	APN	11	105,216,547 (GRCm39)	missense	probably damaging	1.00
IGL02829:Mrc2	APN	11	105,227,533 (GRCm39)	missense	possibly damaging	0.85
IGL02863:Mrc2	APN	11	105,224,446 (GRCm39)	splice site	probably benign
IGL02940:Mrc2	APN	11	105,231,997 (GRCm39)	missense	probably damaging	1.00
IGL02988:Mrc2	UTSW	11	105,216,397 (GRCm39)	missense	probably benign	0.04
R0254:Mrc2	UTSW	11	105,238,692 (GRCm39)	missense	probably benign	0.00
R0634:Mrc2	UTSW	11	105,238,518 (GRCm39)	missense	probably benign	0.01
R1102:Mrc2	UTSW	11	105,231,647 (GRCm39)	missense	probably benign
R1233:Mrc2	UTSW	11	105,239,241 (GRCm39)	missense	probably damaging	1.00
R1244:Mrc2	UTSW	11	105,239,257 (GRCm39)	splice site	probably null
R1458:Mrc2	UTSW	11	105,228,598 (GRCm39)	missense	probably benign	0.01
R1500:Mrc2	UTSW	11	105,238,551 (GRCm39)	missense	probably damaging	1.00
R1573:Mrc2	UTSW	11	105,227,482 (GRCm39)	missense	probably damaging	1.00
R1770:Mrc2	UTSW	11	105,229,619 (GRCm39)	missense	probably damaging	0.99
R1842:Mrc2	UTSW	11	105,228,546 (GRCm39)	missense	probably damaging	0.98
R2156:Mrc2	UTSW	11	105,238,682 (GRCm39)	splice site	probably null
R2165:Mrc2	UTSW	11	105,239,257 (GRCm39)	splice site	probably null
R2265:Mrc2	UTSW	11	105,239,257 (GRCm39)	splice site	probably null
R2266:Mrc2	UTSW	11	105,239,257 (GRCm39)	splice site	probably null
R2267:Mrc2	UTSW	11	105,239,257 (GRCm39)	splice site	probably null
R2268:Mrc2	UTSW	11	105,239,257 (GRCm39)	splice site	probably null
R2269:Mrc2	UTSW	11	105,239,257 (GRCm39)	splice site	probably null
R2270:Mrc2	UTSW	11	105,239,257 (GRCm39)	splice site	probably null
R2271:Mrc2	UTSW	11	105,239,257 (GRCm39)	splice site	probably null
R2272:Mrc2	UTSW	11	105,239,257 (GRCm39)	splice site	probably null
R2296:Mrc2	UTSW	11	105,239,257 (GRCm39)	splice site	probably null
R2298:Mrc2	UTSW	11	105,239,257 (GRCm39)	splice site	probably null
R2300:Mrc2	UTSW	11	105,239,257 (GRCm39)	splice site	probably null
R2326:Mrc2	UTSW	11	105,239,257 (GRCm39)	splice site	probably null
R2518:Mrc2	UTSW	11	105,239,257 (GRCm39)	splice site	probably null
R2519:Mrc2	UTSW	11	105,239,257 (GRCm39)	splice site	probably null
R2520:Mrc2	UTSW	11	105,239,257 (GRCm39)	splice site	probably null
R2895:Mrc2	UTSW	11	105,239,257 (GRCm39)	splice site	probably null
R3029:Mrc2	UTSW	11	105,239,257 (GRCm39)	splice site	probably null
R3030:Mrc2	UTSW	11	105,239,257 (GRCm39)	splice site	probably null
R3079:Mrc2	UTSW	11	105,227,539 (GRCm39)	missense	probably damaging	0.97
R3122:Mrc2	UTSW	11	105,239,257 (GRCm39)	splice site	probably null
R3149:Mrc2	UTSW	11	105,239,257 (GRCm39)	splice site	probably null
R3420:Mrc2	UTSW	11	105,239,257 (GRCm39)	splice site	probably null
R3422:Mrc2	UTSW	11	105,239,257 (GRCm39)	splice site	probably null
R3441:Mrc2	UTSW	11	105,238,542 (GRCm39)	missense	possibly damaging	0.87
R3726:Mrc2	UTSW	11	105,239,257 (GRCm39)	splice site	probably null
R3731:Mrc2	UTSW	11	105,239,257 (GRCm39)	splice site	probably null
R3800:Mrc2	UTSW	11	105,239,257 (GRCm39)	splice site	probably null
R3820:Mrc2	UTSW	11	105,239,257 (GRCm39)	splice site	probably null
R3821:Mrc2	UTSW	11	105,239,257 (GRCm39)	splice site	probably null
R3837:Mrc2	UTSW	11	105,239,257 (GRCm39)	splice site	probably null
R3838:Mrc2	UTSW	11	105,239,257 (GRCm39)	splice site	probably null
R3849:Mrc2	UTSW	11	105,183,729 (GRCm39)	critical splice donor site	probably null
R3850:Mrc2	UTSW	11	105,183,729 (GRCm39)	critical splice donor site	probably null
R3914:Mrc2	UTSW	11	105,238,058 (GRCm39)	splice site	probably benign
R3932:Mrc2	UTSW	11	105,239,257 (GRCm39)	splice site	probably null
R3933:Mrc2	UTSW	11	105,239,257 (GRCm39)	splice site	probably null
R3971:Mrc2	UTSW	11	105,218,857 (GRCm39)	missense	possibly damaging	0.65
R4105:Mrc2	UTSW	11	105,239,257 (GRCm39)	splice site	probably null
R4107:Mrc2	UTSW	11	105,239,257 (GRCm39)	splice site	probably null
R4113:Mrc2	UTSW	11	105,239,257 (GRCm39)	splice site	probably null
R4274:Mrc2	UTSW	11	105,239,257 (GRCm39)	splice site	probably null
R4399:Mrc2	UTSW	11	105,227,484 (GRCm39)	nonsense	probably null
R4477:Mrc2	UTSW	11	105,239,257 (GRCm39)	splice site	probably null
R4478:Mrc2	UTSW	11	105,239,257 (GRCm39)	splice site	probably null
R4493:Mrc2	UTSW	11	105,239,257 (GRCm39)	splice site	probably null
R4494:Mrc2	UTSW	11	105,239,257 (GRCm39)	splice site	probably null
R4495:Mrc2	UTSW	11	105,239,257 (GRCm39)	splice site	probably null
R4547:Mrc2	UTSW	11	105,227,467 (GRCm39)	missense	probably benign	0.04
R4600:Mrc2	UTSW	11	105,239,257 (GRCm39)	splice site	probably null
R4601:Mrc2	UTSW	11	105,239,257 (GRCm39)	splice site	probably null
R4602:Mrc2	UTSW	11	105,239,257 (GRCm39)	splice site	probably null
R4603:Mrc2	UTSW	11	105,239,257 (GRCm39)	splice site	probably null
R4610:Mrc2	UTSW	11	105,239,257 (GRCm39)	splice site	probably null
R4611:Mrc2	UTSW	11	105,239,257 (GRCm39)	splice site	probably null
R4637:Mrc2	UTSW	11	105,239,257 (GRCm39)	splice site	probably null
R4672:Mrc2	UTSW	11	105,233,923 (GRCm39)	missense	probably benign	0.22
R4674:Mrc2	UTSW	11	105,239,257 (GRCm39)	splice site	probably null
R4675:Mrc2	UTSW	11	105,239,257 (GRCm39)	splice site	probably null
R4693:Mrc2	UTSW	11	105,234,528 (GRCm39)	missense	probably benign	0.00
R4706:Mrc2	UTSW	11	105,239,257 (GRCm39)	splice site	probably null
R4707:Mrc2	UTSW	11	105,239,257 (GRCm39)	splice site	probably null
R4791:Mrc2	UTSW	11	105,239,257 (GRCm39)	splice site	probably null
R4792:Mrc2	UTSW	11	105,239,257 (GRCm39)	splice site	probably null
R4888:Mrc2	UTSW	11	105,232,034 (GRCm39)	missense	probably damaging	0.99
R5523:Mrc2	UTSW	11	105,234,408 (GRCm39)	missense	probably benign
R5600:Mrc2	UTSW	11	105,224,492 (GRCm39)	missense	probably damaging	1.00
R5634:Mrc2	UTSW	11	105,227,040 (GRCm39)	nonsense	probably null
R5692:Mrc2	UTSW	11	105,227,468 (GRCm39)	missense	probably damaging	0.99
R5706:Mrc2	UTSW	11	105,223,169 (GRCm39)	missense	probably damaging	1.00
R5775:Mrc2	UTSW	11	105,228,639 (GRCm39)	missense	probably benign	0.00
R6140:Mrc2	UTSW	11	105,237,615 (GRCm39)	missense	probably benign
R6146:Mrc2	UTSW	11	105,216,470 (GRCm39)	missense	probably damaging	0.98
R6225:Mrc2	UTSW	11	105,237,646 (GRCm39)	missense	probably benign	0.01
R6437:Mrc2	UTSW	11	105,240,669 (GRCm39)	missense	probably damaging	1.00
R6618:Mrc2	UTSW	11	105,240,708 (GRCm39)	missense	probably damaging	1.00
R6675:Mrc2	UTSW	11	105,233,906 (GRCm39)	splice site	probably null
R6680:Mrc2	UTSW	11	105,216,579 (GRCm39)	missense	probably damaging	0.98
R6868:Mrc2	UTSW	11	105,219,244 (GRCm39)	missense	probably damaging	1.00
R6979:Mrc2	UTSW	11	105,239,461 (GRCm39)	missense	probably damaging	0.96
R7038:Mrc2	UTSW	11	105,223,062 (GRCm39)	missense	possibly damaging	0.46
R7303:Mrc2	UTSW	11	105,216,629 (GRCm39)	missense	probably damaging	1.00
R7320:Mrc2	UTSW	11	105,220,061 (GRCm39)	missense	possibly damaging	0.92
R7422:Mrc2	UTSW	11	105,183,609 (GRCm39)	start gained	probably benign
R7537:Mrc2	UTSW	11	105,183,623 (GRCm39)	missense	probably benign
R7640:Mrc2	UTSW	11	105,223,121 (GRCm39)	missense	possibly damaging	0.48
R7709:Mrc2	UTSW	11	105,237,285 (GRCm39)	missense	probably benign	0.10
R7885:Mrc2	UTSW	11	105,223,092 (GRCm39)	missense	probably damaging	0.98
R7976:Mrc2	UTSW	11	105,238,829 (GRCm39)	missense	possibly damaging	0.74
R8042:Mrc2	UTSW	11	105,239,181 (GRCm39)	missense	probably damaging	0.98
R8096:Mrc2	UTSW	11	105,234,333 (GRCm39)	missense	probably damaging	1.00
R8353:Mrc2	UTSW	11	105,223,137 (GRCm39)	missense	probably damaging	0.98
R8453:Mrc2	UTSW	11	105,223,137 (GRCm39)	missense	probably damaging	0.98
R8519:Mrc2	UTSW	11	105,238,132 (GRCm39)	missense	possibly damaging	0.62
R8771:Mrc2	UTSW	11	105,240,596 (GRCm39)	missense	probably benign
R8787:Mrc2	UTSW	11	105,238,465 (GRCm39)	missense	probably benign
R8925:Mrc2	UTSW	11	105,216,334 (GRCm39)	missense	probably benign	0.00
R8927:Mrc2	UTSW	11	105,216,334 (GRCm39)	missense	probably benign	0.00
R8991:Mrc2	UTSW	11	105,229,740 (GRCm39)	missense	probably benign
R9017:Mrc2	UTSW	11	105,216,711 (GRCm39)	missense	probably damaging	1.00
R9096:Mrc2	UTSW	11	105,231,398 (GRCm39)	missense	probably damaging	1.00
R9097:Mrc2	UTSW	11	105,231,398 (GRCm39)	missense	probably damaging	1.00
R9223:Mrc2	UTSW	11	105,220,093 (GRCm39)	missense	probably damaging	1.00
R9471:Mrc2	UTSW	11	105,234,559 (GRCm39)	missense	probably benign	0.03
R9531:Mrc2	UTSW	11	105,240,731 (GRCm39)	missense	possibly damaging	0.82
T0970:Mrc2	UTSW	11	105,238,453 (GRCm39)	missense	probably benign	0.41
X0004:Mrc2	UTSW	11	105,238,453 (GRCm39)	missense	probably benign	0.41
X0062:Mrc2	UTSW	11	105,238,301 (GRCm39)	critical splice donor site	probably null
Z1176:Mrc2	UTSW	11	105,238,186 (GRCm39)	nonsense	probably null
Z1176:Mrc2	UTSW	11	105,232,202 (GRCm39)	missense	possibly damaging	0.94

Predicted Primers

PCR Primer
(F):5'- CACCATCTTGCACTTGAGCTG -3'
(R):5'- TGTGGAAGGAACCCATTGG -3'

Sequencing Primer
(F):5'- GGTCTATCACCATAAGGAGAATCTGC -3'
(R):5'- CCATTGGGAAGGTGTGGGAATG -3'

Posted On

2015-03-25