Incidental Mutation 'R3801:Slpi'
ID 272962
Institutional Source Beutler Lab
Gene Symbol Slpi
Ensembl Gene ENSMUSG00000017002
Gene Name secretory leukocyte peptidase inhibitor
Synonyms
MMRRC Submission 040760-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R3801 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 164354070-164389095 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 164356238 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 12 (L12P)
Ref Sequence ENSEMBL: ENSMUSP00000104992 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109367] [ENSMUST00000165980] [ENSMUST00000167427]
AlphaFold P97430
Predicted Effect probably damaging
Transcript: ENSMUST00000109367
AA Change: L12P

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000104992
Gene: ENSMUSG00000017002
AA Change: L12P

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
WAP 32 77 7.06e-5 SMART
WAP 86 131 1.11e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000165980
SMART Domains Protein: ENSMUSP00000128025
Gene: ENSMUSG00000017002

DomainStartEndE-ValueType
WAP 8 53 7.06e-5 SMART
WAP 62 107 1.11e-20 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000167427
AA Change: L12P

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185076
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a secreted inhibitor which protects epithelial tissues from serine proteases. It is found in various secretions including seminal plasma, cervical mucus, and bronchial secretions, and has affinity for trypsin, leukocyte elastase, and cathepsin G. Its inhibitory effect contributes to the immune response by protecting epithelial surfaces from attack by endogenous proteolytic enzymes. This antimicrobial protein has antibacterial, antifungal and antiviral activity. [provided by RefSeq, Nov 2014]
PHENOTYPE: Homozygous null mice been independently reported to exhibit increased susceptibility to LPS-induced endotoxin shock with elevated production of IL-6, impaired cutaneous wound healing with increased inflammation and elastase activity, and high susceptibility to pulmonary mycobacterial infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011L22Rik C T 8: 79,248,293 E54K probably benign Het
Als2 A C 1: 59,167,199 M1634R probably damaging Het
Ankfy1 T C 11: 72,749,420 S531P probably benign Het
Atp6v1e1 A G 6: 120,801,059 Y172H probably benign Het
Brd1 C T 15: 88,717,040 V464M probably damaging Het
Btaf1 A T 19: 36,986,548 T840S probably benign Het
Btaf1 A T 19: 36,988,973 H1047L probably benign Het
Cacnb2 A G 2: 14,824,263 D3G possibly damaging Het
Capn13 G A 17: 73,339,401 P339L probably benign Het
Cgrrf1 G T 14: 46,832,363 G30C probably damaging Het
Crnkl1 T C 2: 145,919,795 D614G probably benign Het
Cyp2c23 C T 19: 44,007,039 V430I probably benign Het
Dazl G A 17: 50,281,281 R289W probably benign Het
Dsg1b C T 18: 20,390,203 P96S probably damaging Het
Dusp14 A G 11: 84,048,709 S169P possibly damaging Het
Egfem1 A G 3: 29,151,926 D91G probably benign Het
Eif1 A G 11: 100,320,824 K95E probably damaging Het
Fap C T 2: 62,546,650 V191I probably benign Het
Flnc T C 6: 29,447,404 Y1069H probably damaging Het
Fndc7 T C 3: 108,869,148 T526A possibly damaging Het
Fras1 A T 5: 96,733,932 T2508S probably benign Het
Gast T C 11: 100,336,810 S73P probably damaging Het
Grap2 A G 15: 80,623,746 T4A possibly damaging Het
Grm8 T G 6: 28,125,636 N164H possibly damaging Het
Hyal5 A T 6: 24,876,524 H132L probably benign Het
Iqcm C A 8: 75,669,393 T188K possibly damaging Het
Kank4 A G 4: 98,780,133 S26P probably damaging Het
Lipo1 C T 19: 33,784,857 C80Y probably damaging Het
Lrrk2 A G 15: 91,737,111 R963G probably benign Het
Lrtm2 G A 6: 119,317,483 T229I probably damaging Het
Mb21d2 A T 16: 28,828,003 D406E possibly damaging Het
Meikin T A 11: 54,399,871 probably null Het
Mybl1 A T 1: 9,673,214 F538I probably damaging Het
Nectin2 T C 7: 19,717,636 D491G probably benign Het
Nf1 A G 11: 79,559,521 D511G probably null Het
Nid2 T C 14: 19,809,997 C1328R probably damaging Het
Nlrp1a T A 11: 71,122,703 M574L probably benign Het
Nrap C T 19: 56,321,779 D1595N probably damaging Het
Nrg3 G A 14: 38,376,434 P496S probably damaging Het
Olfr1287 A T 2: 111,449,565 I142F probably benign Het
Pak3 G A X: 143,709,731 V87I probably damaging Het
Phf8 T C X: 151,572,576 S512P possibly damaging Het
Phkb G T 8: 85,922,229 E225* probably null Het
Plaa T C 4: 94,569,888 D615G probably damaging Het
Prdm12 A G 2: 31,651,947 K223E probably damaging Het
Prkd1 C A 12: 50,383,422 R634L possibly damaging Het
Rassf3 T A 10: 121,414,366 I181F possibly damaging Het
Samd8 G A 14: 21,775,065 V30M probably damaging Het
Sema4f A T 6: 82,918,627 H308Q possibly damaging Het
Skint4 G T 4: 112,118,181 V113L probably damaging Het
Slc16a10 G C 10: 40,056,624 H314D possibly damaging Het
Smco1 A G 16: 32,273,898 Y129C probably benign Het
Spag17 A G 3: 100,053,853 K985R possibly damaging Het
Stc1 T C 14: 69,038,475 I239T probably benign Het
Suclg2 A T 6: 95,497,668 I372N probably damaging Het
Tmed4 C A 11: 6,274,233 V80F probably damaging Het
Tnpo2 T A 8: 85,055,171 probably null Het
Top1 A G 2: 160,702,768 H268R probably damaging Het
Triobp A T 15: 78,973,700 Q1167L probably benign Het
Txndc16 G A 14: 45,151,352 P536L possibly damaging Het
Usp13 C T 3: 32,881,508 A360V possibly damaging Het
Vhl G A 6: 113,629,462 V147I probably benign Het
Vldlr A T 19: 27,217,621 T3S probably damaging Het
Vps54 T A 11: 21,268,832 D130E probably benign Het
Zfp808 T A 13: 62,172,083 H375Q probably damaging Het
Zfp87 A T 13: 67,521,215 N37K probably damaging Het
Other mutations in Slpi
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03032:Slpi APN 2 164355447 unclassified probably benign
IGL03356:Slpi APN 2 164356209 missense probably benign 0.00
R1367:Slpi UTSW 2 164354867 unclassified probably benign
R1459:Slpi UTSW 2 164354917 missense probably damaging 1.00
R1991:Slpi UTSW 2 164355543 missense probably damaging 1.00
R2103:Slpi UTSW 2 164355543 missense probably damaging 1.00
R6473:Slpi UTSW 2 164354926 missense probably damaging 1.00
R7253:Slpi UTSW 2 164355547 missense probably benign 0.01
R7264:Slpi UTSW 2 164356402 start gained probably benign
R8359:Slpi UTSW 2 164356055 start codon destroyed probably null
R8722:Slpi UTSW 2 164356055 start codon destroyed probably null
R9203:Slpi UTSW 2 164354897 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- CTGACAGGATGGCTGCATAAG -3'
(R):5'- TCTGTGGCTAAGCTTCCTGC -3'

Sequencing Primer
(F):5'- AGGAGCACCTCTACATGCCTTG -3'
(R):5'- GGCTAAGCTTCCTGCCTGTG -3'
Posted On 2015-03-25