Incidental Mutation 'R3801:Lipo1'
ID 273022
Institutional Source Beutler Lab
Gene Symbol Lipo1
Ensembl Gene ENSMUSG00000024766
Gene Name lipase, member O1
Synonyms
MMRRC Submission 040760-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock # R3801 (G1)
Quality Score 225
Status Not validated
Chromosome 19
Chromosomal Location 33517740-33590308 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 33784857 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Cysteine to Tyrosine at position 80 (C80Y)
Ref Sequence ENSEMBL: ENSMUSP00000136249 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000178735]
AlphaFold Q3UT41
Predicted Effect unknown
Transcript: ENSMUST00000148137
AA Change: C83Y
SMART Domains Protein: ENSMUSP00000118385
Gene: ENSMUSG00000079342
AA Change: C83Y

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Abhydro_lipase 37 99 2.8e-21 PFAM
Pfam:Hydrolase_4 76 239 4.3e-8 PFAM
Pfam:Abhydrolase_1 80 219 2.2e-17 PFAM
Pfam:Abhydrolase_5 80 233 8.7e-8 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000178735
AA Change: C80Y

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000136249
Gene: ENSMUSG00000079342
AA Change: C80Y

DomainStartEndE-ValueType
Pfam:Abhydro_lipase 33 95 1.3e-20 PFAM
Pfam:Hydrolase_4 72 231 3.5e-8 PFAM
Pfam:Abhydrolase_5 76 370 3.7e-10 PFAM
Pfam:Abhydrolase_1 76 376 6.8e-21 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011L22Rik C T 8: 79,248,293 E54K probably benign Het
Als2 A C 1: 59,167,199 M1634R probably damaging Het
Ankfy1 T C 11: 72,749,420 S531P probably benign Het
Atp6v1e1 A G 6: 120,801,059 Y172H probably benign Het
Brd1 C T 15: 88,717,040 V464M probably damaging Het
Btaf1 A T 19: 36,986,548 T840S probably benign Het
Btaf1 A T 19: 36,988,973 H1047L probably benign Het
Cacnb2 A G 2: 14,824,263 D3G possibly damaging Het
Capn13 G A 17: 73,339,401 P339L probably benign Het
Cgrrf1 G T 14: 46,832,363 G30C probably damaging Het
Crnkl1 T C 2: 145,919,795 D614G probably benign Het
Cyp2c23 C T 19: 44,007,039 V430I probably benign Het
Dazl G A 17: 50,281,281 R289W probably benign Het
Dsg1b C T 18: 20,390,203 P96S probably damaging Het
Dusp14 A G 11: 84,048,709 S169P possibly damaging Het
Egfem1 A G 3: 29,151,926 D91G probably benign Het
Eif1 A G 11: 100,320,824 K95E probably damaging Het
Fap C T 2: 62,546,650 V191I probably benign Het
Flnc T C 6: 29,447,404 Y1069H probably damaging Het
Fndc7 T C 3: 108,869,148 T526A possibly damaging Het
Fras1 A T 5: 96,733,932 T2508S probably benign Het
Gast T C 11: 100,336,810 S73P probably damaging Het
Grap2 A G 15: 80,623,746 T4A possibly damaging Het
Grm8 T G 6: 28,125,636 N164H possibly damaging Het
Hyal5 A T 6: 24,876,524 H132L probably benign Het
Iqcm C A 8: 75,669,393 T188K possibly damaging Het
Kank4 A G 4: 98,780,133 S26P probably damaging Het
Lrrk2 A G 15: 91,737,111 R963G probably benign Het
Lrtm2 G A 6: 119,317,483 T229I probably damaging Het
Mb21d2 A T 16: 28,828,003 D406E possibly damaging Het
Meikin T A 11: 54,399,871 probably null Het
Mybl1 A T 1: 9,673,214 F538I probably damaging Het
Nectin2 T C 7: 19,717,636 D491G probably benign Het
Nf1 A G 11: 79,559,521 D511G probably null Het
Nid2 T C 14: 19,809,997 C1328R probably damaging Het
Nlrp1a T A 11: 71,122,703 M574L probably benign Het
Nrap C T 19: 56,321,779 D1595N probably damaging Het
Nrg3 G A 14: 38,376,434 P496S probably damaging Het
Olfr1287 A T 2: 111,449,565 I142F probably benign Het
Pak3 G A X: 143,709,731 V87I probably damaging Het
Phf8 T C X: 151,572,576 S512P possibly damaging Het
Phkb G T 8: 85,922,229 E225* probably null Het
Plaa T C 4: 94,569,888 D615G probably damaging Het
Prdm12 A G 2: 31,651,947 K223E probably damaging Het
Prkd1 C A 12: 50,383,422 R634L possibly damaging Het
Rassf3 T A 10: 121,414,366 I181F possibly damaging Het
Samd8 G A 14: 21,775,065 V30M probably damaging Het
Sema4f A T 6: 82,918,627 H308Q possibly damaging Het
Skint4 G T 4: 112,118,181 V113L probably damaging Het
Slc16a10 G C 10: 40,056,624 H314D possibly damaging Het
Slpi A G 2: 164,356,238 L12P probably damaging Het
Smco1 A G 16: 32,273,898 Y129C probably benign Het
Spag17 A G 3: 100,053,853 K985R possibly damaging Het
Stc1 T C 14: 69,038,475 I239T probably benign Het
Suclg2 A T 6: 95,497,668 I372N probably damaging Het
Tmed4 C A 11: 6,274,233 V80F probably damaging Het
Tnpo2 T A 8: 85,055,171 probably null Het
Top1 A G 2: 160,702,768 H268R probably damaging Het
Triobp A T 15: 78,973,700 Q1167L probably benign Het
Txndc16 G A 14: 45,151,352 P536L possibly damaging Het
Usp13 C T 3: 32,881,508 A360V possibly damaging Het
Vhl G A 6: 113,629,462 V147I probably benign Het
Vldlr A T 19: 27,217,621 T3S probably damaging Het
Vps54 T A 11: 21,268,832 D130E probably benign Het
Zfp808 T A 13: 62,172,083 H375Q probably damaging Het
Zfp87 A T 13: 67,521,215 N37K probably damaging Het
Other mutations in Lipo1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01521:Lipo1 APN 19 33785683 missense probably damaging 1.00
IGL01916:Lipo1 APN 19 33784782 missense probably damaging 1.00
IGL03005:Lipo1 APN 19 33785736 missense possibly damaging 0.65
R0646:Lipo1 UTSW 19 33784769 nonsense probably null
R1704:Lipo1 UTSW 19 33780343 missense possibly damaging 0.87
R1772:Lipo1 UTSW 19 33787421 missense probably benign 0.45
R1862:Lipo1 UTSW 19 33784692 missense probably damaging 1.00
R1863:Lipo1 UTSW 19 33784692 missense probably damaging 1.00
R3802:Lipo1 UTSW 19 33784857 missense probably damaging 0.99
R3803:Lipo1 UTSW 19 33784857 missense probably damaging 0.99
R4020:Lipo1 UTSW 19 33787404 missense probably benign 0.00
R4648:Lipo1 UTSW 19 33783460 missense probably damaging 1.00
R4775:Lipo1 UTSW 19 33780395 missense probably damaging 1.00
R4787:Lipo1 UTSW 19 33780349 missense probably benign 0.00
R4830:Lipo1 UTSW 19 33776587 missense probably damaging 0.99
R4951:Lipo1 UTSW 19 33782221 missense probably benign 0.01
R5799:Lipo1 UTSW 19 33777693 intron probably benign
R5853:Lipo1 UTSW 19 33782230 missense probably benign 0.37
R6235:Lipo1 UTSW 19 33783563 missense probably damaging 0.96
R6296:Lipo1 UTSW 19 33780337 missense probably benign 0.10
R6913:Lipo1 UTSW 19 33780305 missense probably benign 0.00
R7672:Lipo1 UTSW 19 33780385 missense probably benign 0.23
R7796:Lipo1 UTSW 19 33782234 missense possibly damaging 0.75
R8683:Lipo1 UTSW 19 33782204 missense probably benign 0.04
R9062:Lipo1 UTSW 19 33780314 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAAATGTCTTCAATTCAGACCCAC -3'
(R):5'- TGTGTGCAGTTCCATATTGATTGAC -3'

Sequencing Primer
(F):5'- GGAATTGTTCCCTACCTAAAAGC -3'
(R):5'- GCAGTTCCATATTGATTGACTAACTG -3'
Posted On 2015-03-25