Incidental Mutation 'R3843:Eef1akmt2'
ID277247
Institutional Source Beutler Lab
Gene Symbol Eef1akmt2
Ensembl Gene ENSMUSG00000030960
Gene NameEEF1A lysine methyltransferase 2
SynonymsMettl10, 2010208K18Rik
MMRRC Submission 040783-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3843 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location132827457-132852673 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 132831576 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 134 (V134I)
Ref Sequence ENSEMBL: ENSMUSP00000033257 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033257] [ENSMUST00000120425] [ENSMUST00000124096] [ENSMUST00000152410]
Predicted Effect probably damaging
Transcript: ENSMUST00000033257
AA Change: V134I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000033257
Gene: ENSMUSG00000030960
AA Change: V134I

DomainStartEndE-ValueType
Pfam:Methyltransf_23 42 183 2.8e-9 PFAM
Pfam:PrmA 64 159 8.6e-7 PFAM
Pfam:Methyltransf_31 79 234 1.1e-16 PFAM
Pfam:Methyltransf_18 80 192 7.1e-16 PFAM
Pfam:Methyltransf_11 84 189 2.8e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000120425
SMART Domains Protein: ENSMUSP00000113039
Gene: ENSMUSG00000030960

DomainStartEndE-ValueType
SCOP:d1f3la_ 36 96 8e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000124096
SMART Domains Protein: ENSMUSP00000130971
Gene: ENSMUSG00000030849

DomainStartEndE-ValueType
Pfam:Pkinase 1 118 4.8e-19 PFAM
Pfam:Pkinase_Tyr 1 118 1.7e-50 PFAM
low complexity region 146 160 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135932
Predicted Effect probably benign
Transcript: ENSMUST00000141920
Predicted Effect probably benign
Transcript: ENSMUST00000152410
SMART Domains Protein: ENSMUSP00000140096
Gene: ENSMUSG00000030960

DomainStartEndE-ValueType
SCOP:d1jsxa_ 36 97 8e-5 SMART
Meta Mutation Damage Score 0.1322 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 100% (35/35)
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aass A T 6: 23,092,496 Y168* probably null Het
Amt C T 9: 108,297,221 R62C possibly damaging Het
Arid2 C T 15: 96,351,840 T145I possibly damaging Het
Ccdc8 T C 7: 16,995,114 V176A probably damaging Het
Cdhr1 G T 14: 37,084,927 F440L probably benign Het
Ckap2 A T 8: 22,175,758 N424K probably damaging Het
Col6a1 C T 10: 76,711,341 R730H unknown Het
Dennd1b C A 1: 139,053,354 P102Q probably damaging Het
E2f1 A G 2: 154,560,828 S340P probably benign Het
Elp3 A T 14: 65,565,483 probably null Het
Grap T G 11: 61,660,325 probably null Het
Heatr1 T C 13: 12,435,121 Y1999H probably benign Het
Hectd4 G T 5: 121,259,873 W288L possibly damaging Het
Hnf4g G A 3: 3,651,302 C262Y probably benign Het
Hrh4 A G 18: 13,022,286 Y294C possibly damaging Het
Igkv5-39 C A 6: 69,900,542 G77W probably damaging Het
Kdm2b A T 5: 122,934,793 Y341N probably damaging Het
Kif26b T C 1: 178,928,177 L1952P probably damaging Het
Lgr4 C T 2: 109,996,773 probably benign Het
Nlrc3 G A 16: 3,964,964 R194W probably benign Het
Nup214 T C 2: 32,051,100 F547L probably damaging Het
Olfr1032 A G 2: 86,008,204 I143V probably benign Het
Pdp1 T C 4: 11,961,961 K117E probably benign Het
Phtf2 G A 5: 20,774,022 A31V probably damaging Het
Pkhd1 A T 1: 20,558,723 C667S probably benign Het
Pnp2 T A 14: 50,963,421 L121Q probably null Het
Ppfia1 C T 7: 144,504,970 R698Q probably benign Het
Sidt1 A T 16: 44,284,224 F275I probably benign Het
Slc50a1 A T 3: 89,269,900 I70N probably damaging Het
Sytl2 C G 7: 90,360,159 T123R possibly damaging Het
Tlk1 T A 2: 70,749,327 T214S probably benign Het
Tmco3 A G 8: 13,296,114 probably benign Het
Tmem55a T A 4: 14,886,553 Y42* probably null Het
Trim71 T C 9: 114,515,846 T335A probably benign Het
Zfp651 T A 9: 121,763,433 V273E possibly damaging Het
Other mutations in Eef1akmt2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01548:Eef1akmt2 APN 7 132831405 missense probably damaging 1.00
IGL02477:Eef1akmt2 APN 7 132850589 splice site probably null
IGL02984:Eef1akmt2 UTSW 7 132837206 makesense probably null
R0082:Eef1akmt2 UTSW 7 132851472 nonsense probably null
R5025:Eef1akmt2 UTSW 7 132851489 missense probably damaging 1.00
R6234:Eef1akmt2 UTSW 7 132827856 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGCCTTGGTCCAATTACATGAGG -3'
(R):5'- GAGATTTGAAATGTCCAGGAAACAC -3'

Sequencing Primer
(F):5'- TTGGTCCAATTACATGAGGTTATTAG -3'
(R):5'- GGCTTTAATGATCTAGGAAACAAAGC -3'
Posted On2015-04-06