Incidental Mutation 'R3843:Tmco3'
ID277249
Institutional Source Beutler Lab
Gene Symbol Tmco3
Ensembl Gene ENSMUSG00000038497
Gene Nametransmembrane and coiled-coil domains 3
SynonymsB230339H12Rik
MMRRC Submission 040783-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3843 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location13288190-13322924 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 13296114 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000040347 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045229]
Predicted Effect probably benign
Transcript: ENSMUST00000045229
SMART Domains Protein: ENSMUSP00000040347
Gene: ENSMUSG00000038497

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
coiled coil region 124 204 N/A INTRINSIC
Pfam:Na_H_Exchanger 274 662 9.2e-74 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210063
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210402
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211645
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 100% (35/35)
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aass A T 6: 23,092,496 Y168* probably null Het
Amt C T 9: 108,297,221 R62C possibly damaging Het
Arid2 C T 15: 96,351,840 T145I possibly damaging Het
Ccdc8 T C 7: 16,995,114 V176A probably damaging Het
Cdhr1 G T 14: 37,084,927 F440L probably benign Het
Ckap2 A T 8: 22,175,758 N424K probably damaging Het
Col6a1 C T 10: 76,711,341 R730H unknown Het
Dennd1b C A 1: 139,053,354 P102Q probably damaging Het
E2f1 A G 2: 154,560,828 S340P probably benign Het
Eef1akmt2 C T 7: 132,831,576 V134I probably damaging Het
Elp3 A T 14: 65,565,483 probably null Het
Grap T G 11: 61,660,325 probably null Het
Heatr1 T C 13: 12,435,121 Y1999H probably benign Het
Hectd4 G T 5: 121,259,873 W288L possibly damaging Het
Hnf4g G A 3: 3,651,302 C262Y probably benign Het
Hrh4 A G 18: 13,022,286 Y294C possibly damaging Het
Igkv5-39 C A 6: 69,900,542 G77W probably damaging Het
Kdm2b A T 5: 122,934,793 Y341N probably damaging Het
Kif26b T C 1: 178,928,177 L1952P probably damaging Het
Lgr4 C T 2: 109,996,773 probably benign Het
Nlrc3 G A 16: 3,964,964 R194W probably benign Het
Nup214 T C 2: 32,051,100 F547L probably damaging Het
Olfr1032 A G 2: 86,008,204 I143V probably benign Het
Pdp1 T C 4: 11,961,961 K117E probably benign Het
Phtf2 G A 5: 20,774,022 A31V probably damaging Het
Pkhd1 A T 1: 20,558,723 C667S probably benign Het
Pnp2 T A 14: 50,963,421 L121Q probably null Het
Ppfia1 C T 7: 144,504,970 R698Q probably benign Het
Sidt1 A T 16: 44,284,224 F275I probably benign Het
Slc50a1 A T 3: 89,269,900 I70N probably damaging Het
Sytl2 C G 7: 90,360,159 T123R possibly damaging Het
Tlk1 T A 2: 70,749,327 T214S probably benign Het
Tmem55a T A 4: 14,886,553 Y42* probably null Het
Trim71 T C 9: 114,515,846 T335A probably benign Het
Zfp651 T A 9: 121,763,433 V273E possibly damaging Het
Other mutations in Tmco3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00824:Tmco3 APN 8 13292825 missense probably damaging 1.00
IGL01139:Tmco3 APN 8 13319887 missense possibly damaging 0.92
IGL02116:Tmco3 APN 8 13292706 unclassified probably benign
IGL03114:Tmco3 APN 8 13298205 splice site probably benign
Ganado UTSW 8 13292077 splice site probably null
R0244:Tmco3 UTSW 8 13292037 missense probably damaging 1.00
R0385:Tmco3 UTSW 8 13296027 missense probably damaging 1.00
R0711:Tmco3 UTSW 8 13292039 missense probably damaging 0.96
R1594:Tmco3 UTSW 8 13292052 missense probably damaging 0.98
R1727:Tmco3 UTSW 8 13318866 missense possibly damaging 0.52
R1752:Tmco3 UTSW 8 13291741 missense probably benign
R2375:Tmco3 UTSW 8 13292059 missense possibly damaging 0.72
R2850:Tmco3 UTSW 8 13295024 missense probably benign 0.00
R4003:Tmco3 UTSW 8 13291959 missense probably damaging 0.96
R4059:Tmco3 UTSW 8 13320848 missense probably benign 0.27
R5071:Tmco3 UTSW 8 13292860 nonsense probably null
R5072:Tmco3 UTSW 8 13292860 nonsense probably null
R5456:Tmco3 UTSW 8 13319815 missense probably damaging 0.96
R5556:Tmco3 UTSW 8 13294870 missense probably damaging 0.99
R5826:Tmco3 UTSW 8 13310314 missense probably damaging 0.99
R6200:Tmco3 UTSW 8 13292077 splice site probably null
R6586:Tmco3 UTSW 8 13320894 utr 3 prime probably benign
R6858:Tmco3 UTSW 8 13313924 missense probably damaging 1.00
R6867:Tmco3 UTSW 8 13313927 missense probably damaging 1.00
R6944:Tmco3 UTSW 8 13303729 missense probably damaging 1.00
R7082:Tmco3 UTSW 8 13320847 nonsense probably null
R7192:Tmco3 UTSW 8 13319605 splice site probably null
R7283:Tmco3 UTSW 8 13319605 splice site probably null
R7285:Tmco3 UTSW 8 13319605 splice site probably null
R7287:Tmco3 UTSW 8 13319605 splice site probably null
R7314:Tmco3 UTSW 8 13319605 splice site probably null
R7442:Tmco3 UTSW 8 13320781 missense probably damaging 1.00
R8084:Tmco3 UTSW 8 13303873 missense probably damaging 0.96
R8708:Tmco3 UTSW 8 13295998 missense probably benign
R8755:Tmco3 UTSW 8 13291782 missense probably benign
Predicted Primers PCR Primer
(F):5'- ATCAGAGACCTCTTCCCTGAC -3'
(R):5'- GGCCATTACATCACCAGTCG -3'

Sequencing Primer
(F):5'- GACAACCTCTCTGTGTTCTGAC -3'
(R):5'- TTTAAAGAGACAAACTACCCGTCATC -3'
Posted On2015-04-06