Incidental Mutation 'R0356:Ttll11'
ID29812
Institutional Source Beutler Lab
Gene Symbol Ttll11
Ensembl Gene ENSMUSG00000026885
Gene Nametubulin tyrosine ligase-like family, member 11
Synonyms4932702F08Rik, 4933424A20Rik, D2Ertd624e
MMRRC Submission 038562-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0356 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location35751241-35979913 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 35902676 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 385 (D385G)
Ref Sequence ENSEMBL: ENSMUSP00000108600 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028248] [ENSMUST00000112976] [ENSMUST00000140201] [ENSMUST00000161970] [ENSMUST00000162172]
Predicted Effect possibly damaging
Transcript: ENSMUST00000028248
AA Change: D385G

PolyPhen 2 Score 0.658 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000028248
Gene: ENSMUSG00000026885
AA Change: D385G

DomainStartEndE-ValueType
low complexity region 11 37 N/A INTRINSIC
low complexity region 79 101 N/A INTRINSIC
low complexity region 107 122 N/A INTRINSIC
Pfam:TTL 170 477 9.1e-68 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000112976
AA Change: D385G

PolyPhen 2 Score 0.658 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000108600
Gene: ENSMUSG00000026885
AA Change: D385G

DomainStartEndE-ValueType
low complexity region 11 37 N/A INTRINSIC
low complexity region 79 101 N/A INTRINSIC
low complexity region 107 122 N/A INTRINSIC
Pfam:TTL 170 477 5.9e-68 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127742
Predicted Effect possibly damaging
Transcript: ENSMUST00000140201
AA Change: D201G

PolyPhen 2 Score 0.655 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000124510
Gene: ENSMUSG00000026885
AA Change: D201G

DomainStartEndE-ValueType
Pfam:TTL 1 210 2.9e-50 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160284
Predicted Effect unknown
Transcript: ENSMUST00000160906
AA Change: D201G
SMART Domains Protein: ENSMUSP00000125511
Gene: ENSMUSG00000026885
AA Change: D201G

DomainStartEndE-ValueType
Pfam:TTL 1 304 4.2e-65 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000161970
SMART Domains Protein: ENSMUSP00000125627
Gene: ENSMUSG00000026885

DomainStartEndE-ValueType
SCOP:d1gosa1 33 88 5e-3 SMART
low complexity region 107 122 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162172
AA Change: D201G

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000125199
Gene: ENSMUSG00000026885
AA Change: D201G

DomainStartEndE-ValueType
Pfam:TTL 1 204 1.2e-48 PFAM
Meta Mutation Damage Score 0.8699 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.6%
  • 10x: 94.4%
  • 20x: 86.1%
Validation Efficiency 100% (47/47)
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921530L21Rik T A 14: 95,882,365 V186E possibly damaging Het
9430097D07Rik T C 2: 32,574,406 probably benign Het
Adgrg6 C T 10: 14,426,898 V924M possibly damaging Het
Akap2 C A 4: 57,855,628 T360K possibly damaging Het
Anxa9 A G 3: 95,308,076 probably benign Het
Ap3d1 G T 10: 80,727,978 S122R probably damaging Het
Arhgap5 T C 12: 52,516,308 S21P probably damaging Het
Atp13a5 A G 16: 29,348,755 probably benign Het
AU040320 A T 4: 126,837,362 D618V probably damaging Het
Cbfa2t2 T A 2: 154,531,349 D475E probably benign Het
Ccdc62 G A 5: 123,954,748 V599I probably benign Het
Cenpj T C 14: 56,549,496 E917G probably damaging Het
Cog5 T C 12: 31,837,181 probably benign Het
Col9a1 T A 1: 24,185,247 L170* probably null Het
Daxx T A 17: 33,913,893 V627D probably benign Het
Dnah9 A G 11: 66,130,562 probably null Het
Drg2 T A 11: 60,461,581 V203E probably damaging Het
Fbxl17 G A 17: 63,356,851 R67C probably damaging Het
Fer1l4 T C 2: 156,024,010 Y1586C probably damaging Het
Gp6 A T 7: 4,370,142 probably benign Het
Hhip T C 8: 79,997,492 I374V probably benign Het
Hspa12b G T 2: 131,144,799 V547L possibly damaging Het
Iars G A 13: 49,703,233 V321I probably benign Het
Itga8 T C 2: 12,182,721 M716V possibly damaging Het
Lcn5 T C 2: 25,660,693 I131T probably damaging Het
Mki67 G A 7: 135,704,406 T614M probably benign Het
Mmp3 G A 9: 7,451,768 E369K probably benign Het
Myt1l A G 12: 29,811,501 D94G unknown Het
Neil1 T C 9: 57,146,896 I47V possibly damaging Het
Nr5a2 T C 1: 136,845,692 N424S possibly damaging Het
Olfr1477 A G 19: 13,503,077 T245A possibly damaging Het
Olfr380 A T 11: 73,454,080 I44N possibly damaging Het
Olfr561 A T 7: 102,775,079 D185V probably damaging Het
Olfr857 G T 9: 19,713,447 G207C probably damaging Het
Pde8b G T 13: 95,046,454 N265K probably damaging Het
Prpf40b T C 15: 99,305,199 probably null Het
Samd9l T C 6: 3,375,107 D718G possibly damaging Het
Sirpb1c T C 3: 15,833,145 N175D possibly damaging Het
Srgap1 A T 10: 121,855,536 probably null Het
Tgm5 T A 2: 121,053,574 T313S probably damaging Het
Tigar A G 6: 127,091,182 probably null Het
Tmprss11b A G 5: 86,660,467 *417Q probably null Het
Trim32 G A 4: 65,613,254 R16Q probably damaging Het
Zfp426 T C 9: 20,471,245 T135A probably benign Het
Other mutations in Ttll11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00815:Ttll11 APN 2 35902720 nonsense probably null
IGL01148:Ttll11 APN 2 35784193 missense probably damaging 0.96
IGL02933:Ttll11 APN 2 35979410 missense probably benign
e-suppressor UTSW 2 35752406 missense probably damaging 1.00
R0494:Ttll11 UTSW 2 35944874 missense probably damaging 1.00
R1494:Ttll11 UTSW 2 35795379 missense probably damaging 1.00
R1630:Ttll11 UTSW 2 35889325 missense probably damaging 0.96
R1688:Ttll11 UTSW 2 35795379 missense probably damaging 1.00
R1939:Ttll11 UTSW 2 35940753 missense probably null
R2414:Ttll11 UTSW 2 35979534 missense unknown
R2986:Ttll11 UTSW 2 35817738 missense probably benign 0.00
R4295:Ttll11 UTSW 2 35979552 small deletion probably benign
R4346:Ttll11 UTSW 2 35784118 missense probably benign 0.22
R5234:Ttll11 UTSW 2 35940733 missense probably damaging 1.00
R5340:Ttll11 UTSW 2 35902789 missense probably damaging 0.99
R5442:Ttll11 UTSW 2 35903123 makesense probably null
R5482:Ttll11 UTSW 2 35752406 missense probably damaging 1.00
R5604:Ttll11 UTSW 2 35817786 missense probably benign 0.07
R6219:Ttll11 UTSW 2 35752499 splice site probably null
R6481:Ttll11 UTSW 2 35902754 missense probably damaging 1.00
R6764:Ttll11 UTSW 2 35890448 intron probably null
R6944:Ttll11 UTSW 2 35752294 missense probably benign 0.05
R7224:Ttll11 UTSW 2 35902673 missense probably damaging 1.00
R7511:Ttll11 UTSW 2 35903034 missense probably damaging 1.00
R8030:Ttll11 UTSW 2 35902673 missense probably damaging 1.00
R8052:Ttll11 UTSW 2 35979515 missense unknown
R8200:Ttll11 UTSW 2 35944928 missense probably damaging 1.00
X0026:Ttll11 UTSW 2 35795352 splice site probably null
Predicted Primers PCR Primer
(F):5'- TCACATAGCCAAGGAGCCTTTCCC -3'
(R):5'- TCGACAAACTCAAGTTCGACATCCG -3'

Sequencing Primer
(F):5'- TTTCCCCAGCCCAGTCAAG -3'
(R):5'- AAGTTCGACATCCGTCTGTATG -3'
Posted On2013-04-24