Incidental Mutation 'R3897:Man2b1'
ID309014
Institutional Source Beutler Lab
Gene Symbol Man2b1
Ensembl Gene ENSMUSG00000005142
Gene Namemannosidase 2, alpha B1
Synonymslysosomal alpha-mannosidase
MMRRC Submission 040808-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3897 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location85083270-85098282 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) G to T at 85096948 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000034121 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034121]
Predicted Effect probably benign
Transcript: ENSMUST00000034121
SMART Domains Protein: ENSMUSP00000034121
Gene: ENSMUSG00000005142

DomainStartEndE-ValueType
low complexity region 40 51 N/A INTRINSIC
Pfam:Glyco_hydro_38 64 381 2.7e-96 PFAM
Alpha-mann_mid 386 465 4.25e-23 SMART
Pfam:Glyco_hydro_38C 510 1002 6.2e-106 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency 97% (35/36)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme that hydrolyzes terminal, non-reducing alpha-D-mannose residues in alpha-D-mannosides. Its activity is necessary for the catabolism of N-linked carbohydrates released during glycoprotein turnover and it is member of family 38 of glycosyl hydrolases. The full length protein is processed in two steps. First, a 49 aa leader sequence is cleaved off and the remainder of the protein is processed into 3 peptides of 70 kDa, 42 kDa (D) and 13/15 kDa (E). Next, the 70 kDa peptide is further processed into three peptides (A, B and C). The A, B and C peptides are disulfide-linked. Defects in this gene have been associated with lysosomal alpha-mannosidosis. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Mar 2010]
PHENOTYPE: Mice homozygous for a knock-out allele show urinary oligosaccharide excretion, storage of neutral sugars, oligosaccharide buildup in spleen, kidney, liver, testis and brain, clear vacuoles and axonal spheroids in CNS, PNS and other cell types, behavioralchanges, and enhanced long-term potentiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933406M09Rik A G 1: 134,390,438 D316G possibly damaging Het
Adam15 T C 3: 89,346,938 H184R probably benign Het
Ap1g1 A G 8: 109,854,999 D633G probably damaging Het
Arhgef28 C T 13: 97,956,576 R999H probably damaging Het
Armc3 T C 2: 19,269,177 S341P probably damaging Het
Cmya5 T C 13: 93,096,681 E633G possibly damaging Het
Colgalt1 G A 8: 71,619,662 M275I probably damaging Het
Commd7 T C 2: 153,622,790 T23A probably benign Het
Cts3 A G 13: 61,564,986 Y307H probably benign Het
Dlgap4 C A 2: 156,746,069 P89Q probably damaging Het
Ecm1 A G 3: 95,735,986 L334P probably damaging Het
Fzd8 G A 18: 9,214,939 V674I possibly damaging Het
Gosr2 A G 11: 103,697,646 Y5H possibly damaging Het
Gria4 T A 9: 4,513,260 D283V probably damaging Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Iqcm C T 8: 75,753,400 R329C probably damaging Het
Kdm4b T C 17: 56,396,955 C233R probably damaging Het
Ltbp1 T C 17: 75,274,016 C391R probably damaging Het
Nisch A G 14: 31,191,000 probably benign Het
Nrxn2 T G 19: 6,519,257 D1394E probably damaging Het
Olfr1259 T C 2: 89,943,809 E102G probably benign Het
Olfr1283 T C 2: 111,368,761 L43P possibly damaging Het
Pabpc6 T C 17: 9,669,127 D165G probably benign Het
Psat1 A G 19: 15,919,453 probably null Het
Psd A C 19: 46,324,585 N115K possibly damaging Het
Rfwd3 C T 8: 111,288,242 R326Q probably damaging Het
Rnf144a A G 12: 26,310,713 V275A probably damaging Het
Slc35b3 A G 13: 38,934,763 F356L probably benign Het
Tmc4 A G 7: 3,671,088 V364A probably benign Het
Tmem203 T C 2: 25,255,923 F85S probably benign Het
Tra2a T C 6: 49,245,542 probably benign Het
Ttc21b C T 2: 66,235,069 E454K probably benign Het
Other mutations in Man2b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00588:Man2b1 APN 8 85084638 splice site probably null
IGL00671:Man2b1 APN 8 85093938 missense probably damaging 0.98
IGL01538:Man2b1 APN 8 85097430 missense probably benign 0.00
dateline UTSW 8 85084737 missense probably damaging 1.00
greenwich UTSW 8 85085456 nonsense probably null
meridian UTSW 8 85096752 missense probably damaging 1.00
R0018:Man2b1 UTSW 8 85097489 missense probably damaging 1.00
R0302:Man2b1 UTSW 8 85093016 missense probably damaging 1.00
R0574:Man2b1 UTSW 8 85096776 missense probably benign
R0727:Man2b1 UTSW 8 85091526 missense probably damaging 1.00
R0837:Man2b1 UTSW 8 85096829 missense possibly damaging 0.92
R1087:Man2b1 UTSW 8 85095171 missense probably damaging 1.00
R1471:Man2b1 UTSW 8 85086845 missense probably damaging 0.99
R1745:Man2b1 UTSW 8 85093934 missense probably damaging 1.00
R1903:Man2b1 UTSW 8 85086822 missense probably damaging 1.00
R2026:Man2b1 UTSW 8 85095335 missense probably damaging 0.99
R2071:Man2b1 UTSW 8 85085384 missense possibly damaging 0.90
R2120:Man2b1 UTSW 8 85093024 splice site probably benign
R3971:Man2b1 UTSW 8 85085391 missense probably damaging 0.98
R3972:Man2b1 UTSW 8 85085391 missense probably damaging 0.98
R4096:Man2b1 UTSW 8 85084737 missense probably damaging 1.00
R4497:Man2b1 UTSW 8 85090936 missense probably benign 0.22
R5183:Man2b1 UTSW 8 85095784 missense probably damaging 1.00
R5191:Man2b1 UTSW 8 85084459 missense probably damaging 1.00
R5644:Man2b1 UTSW 8 85094210 missense possibly damaging 0.61
R6027:Man2b1 UTSW 8 85096752 missense probably damaging 1.00
R6291:Man2b1 UTSW 8 85097046 missense probably benign 0.44
R6341:Man2b1 UTSW 8 85095399 missense probably damaging 1.00
R6467:Man2b1 UTSW 8 85097447 missense possibly damaging 0.91
R6622:Man2b1 UTSW 8 85084479 missense probably damaging 1.00
R6624:Man2b1 UTSW 8 85096853 missense probably benign 0.01
R6631:Man2b1 UTSW 8 85086811 splice site probably null
R6828:Man2b1 UTSW 8 85086919 missense possibly damaging 0.88
R6983:Man2b1 UTSW 8 85091071 splice site probably null
R7159:Man2b1 UTSW 8 85087280 missense probably benign 0.09
R7267:Man2b1 UTSW 8 85087175 missense probably damaging 1.00
R7537:Man2b1 UTSW 8 85090965 nonsense probably null
R7786:Man2b1 UTSW 8 85085456 nonsense probably null
R8022:Man2b1 UTSW 8 85095613 missense probably damaging 1.00
R8069:Man2b1 UTSW 8 85097045 missense probably benign 0.03
R8251:Man2b1 UTSW 8 85095129 missense probably damaging 0.99
R8406:Man2b1 UTSW 8 85096278 missense probably damaging 1.00
R8464:Man2b1 UTSW 8 85094143 missense possibly damaging 0.55
R8701:Man2b1 UTSW 8 85095153 missense probably damaging 1.00
R8792:Man2b1 UTSW 8 85095144 nonsense probably null
R8891:Man2b1 UTSW 8 85084455 missense probably damaging 1.00
R8930:Man2b1 UTSW 8 85095393 missense probably damaging 1.00
R8932:Man2b1 UTSW 8 85095393 missense probably damaging 1.00
R8953:Man2b1 UTSW 8 85091910 missense probably benign 0.36
Z1176:Man2b1 UTSW 8 85093938 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CAGGTGCATTTGCTCACACTG -3'
(R):5'- CTTGTTGGATGCACTGCTCAC -3'

Sequencing Primer
(F):5'- GGCCAAAGATGCTGCTGCTG -3'
(R):5'- GTTGGATGCACTGCTCACTGTAAAC -3'
Posted On2015-04-17