Incidental Mutation 'R8792:Man2b1'
ID670999
Institutional Source Beutler Lab
Gene Symbol Man2b1
Ensembl Gene ENSMUSG00000005142
Gene Namemannosidase 2, alpha B1
Synonymslysosomal alpha-mannosidase
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8792 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location85083270-85098282 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 85095144 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 692 (Q692*)
Ref Sequence ENSEMBL: ENSMUSP00000034121 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034121]
Predicted Effect probably null
Transcript: ENSMUST00000034121
AA Change: Q692*
SMART Domains Protein: ENSMUSP00000034121
Gene: ENSMUSG00000005142
AA Change: Q692*

DomainStartEndE-ValueType
low complexity region 40 51 N/A INTRINSIC
Pfam:Glyco_hydro_38 64 381 2.7e-96 PFAM
Alpha-mann_mid 386 465 4.25e-23 SMART
Pfam:Glyco_hydro_38C 510 1002 6.2e-106 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme that hydrolyzes terminal, non-reducing alpha-D-mannose residues in alpha-D-mannosides. Its activity is necessary for the catabolism of N-linked carbohydrates released during glycoprotein turnover and it is member of family 38 of glycosyl hydrolases. The full length protein is processed in two steps. First, a 49 aa leader sequence is cleaved off and the remainder of the protein is processed into 3 peptides of 70 kDa, 42 kDa (D) and 13/15 kDa (E). Next, the 70 kDa peptide is further processed into three peptides (A, B and C). The A, B and C peptides are disulfide-linked. Defects in this gene have been associated with lysosomal alpha-mannosidosis. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Mar 2010]
PHENOTYPE: Mice homozygous for a knock-out allele show urinary oligosaccharide excretion, storage of neutral sugars, oligosaccharide buildup in spleen, kidney, liver, testis and brain, clear vacuoles and axonal spheroids in CNS, PNS and other cell types, behavioralchanges, and enhanced long-term potentiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aco2 T C 15: 81,909,496 I382T probably damaging Het
Adam39 G T 8: 40,826,576 R668L probably benign Het
Adam6b T C 12: 113,491,690 I709T possibly damaging Het
Adgrl3 A G 5: 81,688,675 E692G probably damaging Het
Asxl2 T C 12: 3,496,536 L440P probably benign Het
Bmf A G 2: 118,546,905 F121L probably damaging Het
Cdk9 A T 2: 32,708,257 F262L probably benign Het
Clock T A 5: 76,262,727 D99V probably damaging Het
Dnah14 A T 1: 181,814,624 T102S Het
Eps15 T C 4: 109,305,711 V67A probably benign Het
Fam171b T A 2: 83,812,759 L4H probably damaging Het
Fam214b G A 4: 43,033,546 P536S probably damaging Het
Fam71d C T 12: 78,715,150 T196M probably damaging Het
Fcho2 T A 13: 98,815,261 probably benign Het
Gal3st4 C T 5: 138,270,989 V70M probably damaging Het
Gif C A 19: 11,750,235 A141E probably damaging Het
Got1l1 C A 8: 27,200,721 probably null Het
Gpr146 A G 5: 139,392,794 Y117C probably damaging Het
Gpr158 G A 2: 21,553,326 V346M probably damaging Het
Herc1 C A 9: 66,465,486 P3108Q probably damaging Het
Hoxc9 A G 15: 102,981,794 S48G probably benign Het
Lama4 T G 10: 39,048,052 I485M probably benign Het
Lrp4 C T 2: 91,494,955 T1375I possibly damaging Het
Lrp6 T C 6: 134,486,586 Y544C probably damaging Het
Mark2 G T 19: 7,281,215 H570N probably benign Het
Mlph T C 1: 90,942,960 probably benign Het
Mnx1 G A 5: 29,478,374 probably benign Het
Nkx2-2 A T 2: 147,177,893 V208E probably benign Het
Nlrp1b T C 11: 71,160,093 I1058V probably benign Het
Nwd2 T C 5: 63,805,704 I877T probably damaging Het
Olfml2b A T 1: 170,681,100 N509I possibly damaging Het
Olfr1226 T C 2: 89,193,887 Y49C probably benign Het
Olfr1307 G C 2: 111,944,728 H243D probably damaging Het
Olfr387-ps1 T C 11: 73,664,645 L12P probably damaging Het
Pabpc6 T C 17: 9,669,403 N73S probably damaging Het
Parp12 A G 6: 39,089,050 F580L probably benign Het
Parvg C A 15: 84,328,959 H80Q probably damaging Het
Pcdhb14 T C 18: 37,449,488 V549A probably damaging Het
Pde8b T A 13: 95,043,026 H374L probably benign Het
Phf2 C T 13: 48,817,505 probably benign Het
Pld4 T C 12: 112,763,490 F69L probably benign Het
Qrich2 T C 11: 116,456,630 I1123V unknown Het
Rida C T 15: 34,495,096 V8M possibly damaging Het
Rnf19b T A 4: 129,058,685 C139S probably damaging Het
Rp1 T C 1: 4,024,868 I1254M unknown Het
Rpl3l A G 17: 24,728,473 T2A possibly damaging Het
Serpinb6e A T 13: 33,838,959 I147N possibly damaging Het
Slc12a4 G A 8: 105,946,758 T727I probably damaging Het
Slc25a16 C T 10: 62,928,340 R59* probably null Het
Strc T A 2: 121,377,805 I362F probably damaging Het
Tbc1d5 TTGCTGCTGCTGCTGCTG TTGCTGCTGCTGCTGCTGCTG 17: 50,799,934 probably benign Het
Tll1 T A 8: 64,085,465 T382S probably damaging Het
Tmem246 T C 4: 49,587,067 T34A possibly damaging Het
Tmprss6 T A 15: 78,444,128 D556V probably damaging Het
Ttc13 A G 8: 124,674,360 probably null Het
Ttc30a1 C A 2: 75,981,554 E62* probably null Het
Usp43 T A 11: 67,876,418 K709* probably null Het
Vcan A T 13: 89,692,111 N1771K possibly damaging Het
Zfyve16 T C 13: 92,523,161 I81V probably benign Het
Zxdc A G 6: 90,370,004 T116A probably benign Het
Other mutations in Man2b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00588:Man2b1 APN 8 85084638 splice site probably null
IGL00671:Man2b1 APN 8 85093938 missense probably damaging 0.98
IGL01538:Man2b1 APN 8 85097430 missense probably benign 0.00
dateline UTSW 8 85084737 missense probably damaging 1.00
greenwich UTSW 8 85085456 nonsense probably null
meridian UTSW 8 85096752 missense probably damaging 1.00
R0018:Man2b1 UTSW 8 85097489 missense probably damaging 1.00
R0302:Man2b1 UTSW 8 85093016 missense probably damaging 1.00
R0574:Man2b1 UTSW 8 85096776 missense probably benign
R0727:Man2b1 UTSW 8 85091526 missense probably damaging 1.00
R0837:Man2b1 UTSW 8 85096829 missense possibly damaging 0.92
R1087:Man2b1 UTSW 8 85095171 missense probably damaging 1.00
R1471:Man2b1 UTSW 8 85086845 missense probably damaging 0.99
R1745:Man2b1 UTSW 8 85093934 missense probably damaging 1.00
R1903:Man2b1 UTSW 8 85086822 missense probably damaging 1.00
R2026:Man2b1 UTSW 8 85095335 missense probably damaging 0.99
R2071:Man2b1 UTSW 8 85085384 missense possibly damaging 0.90
R2120:Man2b1 UTSW 8 85093024 splice site probably benign
R3897:Man2b1 UTSW 8 85096948 splice site probably benign
R3971:Man2b1 UTSW 8 85085391 missense probably damaging 0.98
R3972:Man2b1 UTSW 8 85085391 missense probably damaging 0.98
R4096:Man2b1 UTSW 8 85084737 missense probably damaging 1.00
R4497:Man2b1 UTSW 8 85090936 missense probably benign 0.22
R5183:Man2b1 UTSW 8 85095784 missense probably damaging 1.00
R5191:Man2b1 UTSW 8 85084459 missense probably damaging 1.00
R5644:Man2b1 UTSW 8 85094210 missense possibly damaging 0.61
R6027:Man2b1 UTSW 8 85096752 missense probably damaging 1.00
R6291:Man2b1 UTSW 8 85097046 missense probably benign 0.44
R6341:Man2b1 UTSW 8 85095399 missense probably damaging 1.00
R6467:Man2b1 UTSW 8 85097447 missense possibly damaging 0.91
R6622:Man2b1 UTSW 8 85084479 missense probably damaging 1.00
R6624:Man2b1 UTSW 8 85096853 missense probably benign 0.01
R6631:Man2b1 UTSW 8 85086811 splice site probably null
R6828:Man2b1 UTSW 8 85086919 missense possibly damaging 0.88
R6983:Man2b1 UTSW 8 85091071 splice site probably null
R7159:Man2b1 UTSW 8 85087280 missense probably benign 0.09
R7267:Man2b1 UTSW 8 85087175 missense probably damaging 1.00
R7537:Man2b1 UTSW 8 85090965 nonsense probably null
R7786:Man2b1 UTSW 8 85085456 nonsense probably null
R8022:Man2b1 UTSW 8 85095613 missense probably damaging 1.00
R8069:Man2b1 UTSW 8 85097045 missense probably benign 0.03
R8251:Man2b1 UTSW 8 85095129 missense probably damaging 0.99
R8406:Man2b1 UTSW 8 85096278 missense probably damaging 1.00
R8464:Man2b1 UTSW 8 85094143 missense possibly damaging 0.55
R8701:Man2b1 UTSW 8 85095153 missense probably damaging 1.00
R8891:Man2b1 UTSW 8 85084455 missense probably damaging 1.00
R8930:Man2b1 UTSW 8 85095393 missense probably damaging 1.00
R8932:Man2b1 UTSW 8 85095393 missense probably damaging 1.00
R8953:Man2b1 UTSW 8 85091910 missense probably benign 0.36
Z1176:Man2b1 UTSW 8 85093938 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GCAAATGAATAAAGGCCTGAGTTC -3'
(R):5'- GAAAAGGAACCCTGTGAGTCC -3'

Sequencing Primer
(F):5'- AAAGGCCTGAGTTCTATCTAGGTCC -3'
(R):5'- GAACCCTGTGAGTCCCCTAAG -3'
Posted On2021-04-30