Incidental Mutation 'R4027:Ano10'
ID313044
Institutional Source Beutler Lab
Gene Symbol Ano10
Ensembl Gene ENSMUSG00000037949
Gene Nameanoctamin 10
SynonymsTmem16k
MMRRC Submission 040850-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.130) question?
Stock #R4027 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location122175874-122294423 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 122252928 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000150161 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042546] [ENSMUST00000214283] [ENSMUST00000214409] [ENSMUST00000214507] [ENSMUST00000216081] [ENSMUST00000216670]
Predicted Effect probably benign
Transcript: ENSMUST00000042546
SMART Domains Protein: ENSMUSP00000045214
Gene: ENSMUSG00000037949

DomainStartEndE-ValueType
Pfam:Anoctamin 200 628 2.2e-115 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214283
Predicted Effect probably benign
Transcript: ENSMUST00000214409
Predicted Effect probably benign
Transcript: ENSMUST00000214507
Predicted Effect probably benign
Transcript: ENSMUST00000216081
Predicted Effect probably benign
Transcript: ENSMUST00000216670
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency 97% (60/62)
MGI Phenotype FUNCTION: This gene encodes a member of the anoctamin family, which in mammals is comprised of 10 members. Anoctamin proteins are proposed to have eight transmembrane domains with both termini facing the cytoplasm and a C-terminal domain of unknown function. While some members have been characterized as calcium-activated chloride channels, this protein is reported to inhibit anion conductance. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Dec 2012]
PHENOTYPE: Mice homozygous for a knock-out allele fail to exhibit calcium-activated chloride ion secretion in the jejunum. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402F06Rik A G 2: 35,380,396 F98L probably damaging Het
Adam26b T C 8: 43,520,372 N531S probably benign Het
Ahdc1 T C 4: 133,064,165 S906P possibly damaging Het
Ank A G 15: 27,544,257 N35D probably damaging Het
Atp4a T C 7: 30,724,952 probably null Het
C030005K15Rik T C 10: 97,725,542 Y109C unknown Het
Carmil1 T A 13: 24,067,223 probably benign Het
Ccl2 A G 11: 82,037,059 R110G probably benign Het
Cntnap2 C A 6: 46,856,128 F758L probably benign Het
Cog6 A C 3: 53,002,529 D267E possibly damaging Het
Cyp4f37 G T 17: 32,631,672 E366D probably benign Het
Dcun1d4 A G 5: 73,534,637 D89G probably damaging Het
Dpep1 T C 8: 123,194,153 V24A probably benign Het
Eefsec T C 6: 88,376,250 I48V probably benign Het
Elmo2 G A 2: 165,294,249 Q195* probably null Het
Ephb3 A G 16: 21,221,697 D561G probably damaging Het
Erich2 C A 2: 70,512,790 probably benign Het
Gatm A G 2: 122,597,446 V362A probably damaging Het
Gdf10 A G 14: 33,932,615 M360V probably damaging Het
Gpr141 T C 13: 19,751,825 N260S probably benign Het
Hectd1 T A 12: 51,802,436 probably null Het
Insrr A G 3: 87,809,599 E682G probably benign Het
Itgax A G 7: 128,141,266 I742V possibly damaging Het
Kcnh1 T C 1: 192,276,699 V187A probably benign Het
Kdm6b G T 11: 69,406,268 S419R possibly damaging Het
Kmt2a A T 9: 44,836,693 probably benign Het
Krt10 A G 11: 99,386,193 probably benign Het
Lct G A 1: 128,285,181 R1912C probably benign Het
Lefty1 T C 1: 180,937,781 S305P probably benign Het
Mast3 A G 8: 70,787,908 L279P probably damaging Het
Mfsd4b3 T C 10: 39,947,347 T306A probably benign Het
Mgam G A 6: 40,754,902 R1351Q probably damaging Het
Mknk1 T A 4: 115,864,561 F101I probably damaging Het
Mlc1 T C 15: 88,966,494 I154V probably benign Het
Myo5b T C 18: 74,759,240 I1685T possibly damaging Het
Nacc2 T A 2: 26,060,336 M463L probably benign Het
Nek11 A C 9: 105,244,390 Y443* probably null Het
Nme4 T C 17: 26,094,222 probably null Het
Nova1 A G 12: 46,817,018 probably benign Het
Olfr651 A T 7: 104,553,323 I135F possibly damaging Het
Parp10 A G 15: 76,241,154 probably null Het
Pkd1l3 T A 8: 109,623,971 S483T possibly damaging Het
Plce1 T C 19: 38,524,265 S3P probably damaging Het
Pnldc1 T C 17: 12,890,779 D400G probably benign Het
Polr2b G A 5: 77,348,405 R1141H possibly damaging Het
Prmt6 A G 3: 110,249,941 I344T probably damaging Het
Psmd2 G A 16: 20,663,205 G896D probably damaging Het
Ranbp17 C T 11: 33,500,718 R73Q possibly damaging Het
Rcn1 G T 2: 105,399,050 Y52* probably null Het
Reck T C 4: 43,922,931 I402T probably damaging Het
Tecpr1 C A 5: 144,206,259 A735S probably benign Het
Tshz1 T C 18: 84,014,829 K485E possibly damaging Het
Ube4a G A 9: 44,949,900 probably benign Het
Vldlr A G 19: 27,238,313 T237A probably benign Het
Vmn1r74 C A 7: 11,846,971 T66K probably damaging Het
Wdr49 C A 3: 75,323,665 L563F probably benign Het
Zmym1 C T 4: 127,049,879 V239I probably benign Het
Zmym5 T A 14: 56,797,811 T267S probably benign Het
Other mutations in Ano10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00545:Ano10 APN 9 122261356 missense possibly damaging 0.96
IGL00886:Ano10 APN 9 122271324 missense probably benign 0.01
IGL00932:Ano10 APN 9 122251231 nonsense probably null
IGL01613:Ano10 APN 9 122259540 missense possibly damaging 0.75
IGL02109:Ano10 APN 9 122261342 missense probably damaging 1.00
IGL02397:Ano10 APN 9 122261392 missense probably damaging 1.00
IGL02512:Ano10 APN 9 122272474 missense possibly damaging 0.50
IGL03216:Ano10 APN 9 122257061 missense probably damaging 1.00
arna UTSW 9 122259564 missense possibly damaging 0.77
R0624:Ano10 UTSW 9 122259595 splice site probably benign
R1669:Ano10 UTSW 9 122257183 missense possibly damaging 0.94
R1801:Ano10 UTSW 9 122253030 missense probably damaging 1.00
R2511:Ano10 UTSW 9 122258945 missense probably damaging 0.99
R3836:Ano10 UTSW 9 122263763 missense possibly damaging 0.58
R4151:Ano10 UTSW 9 122261535 nonsense probably null
R4590:Ano10 UTSW 9 122257165 missense probably benign 0.22
R4651:Ano10 UTSW 9 122261115 nonsense probably null
R4652:Ano10 UTSW 9 122261115 nonsense probably null
R4676:Ano10 UTSW 9 122263787 missense probably damaging 0.98
R5026:Ano10 UTSW 9 122272559 nonsense probably null
R5281:Ano10 UTSW 9 122261486 missense probably damaging 1.00
R5401:Ano10 UTSW 9 122261290 missense probably damaging 1.00
R6269:Ano10 UTSW 9 122261242 missense probably damaging 0.99
R6449:Ano10 UTSW 9 122201688 intron probably benign
R6702:Ano10 UTSW 9 122259564 missense possibly damaging 0.77
R7010:Ano10 UTSW 9 122253124 missense probably damaging 1.00
R7384:Ano10 UTSW 9 122176343 missense unknown
R7584:Ano10 UTSW 9 122275531 missense probably benign
Predicted Primers PCR Primer
(F):5'- GTTCCTCTCAGACAGTACCAC -3'
(R):5'- ACCTGGAGTTGTTCCTGCAG -3'

Sequencing Primer
(F):5'- TTCTATAAACAGTGCACACCTGG -3'
(R):5'- CCTGCAGTTTGGCTATGTGAG -3'
Posted On2015-04-30