Mutagenetix > Incidental Mutations

Incidental Mutation 'R4027:Ephb3'

313063

Institutional Source

Beutler Lab

Gene Symbol

Ephb3

Ensembl Gene

ENSMUSG00000005958

Gene Name

Eph receptor B3

Synonyms

Tyro6, HEK2, MDK5, Sek4, Etk2, Cek10

MMRRC Submission

040850-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.911) question?

Stock #

R4027 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

21204755-21223305 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 21221697 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 561 (D561G)

Ref Sequence

ENSEMBL: ENSMUSP00000124375 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000006112] [ENSMUST00000161063]

AlphaFold

P54754

Predicted Effect

probably damaging
Transcript: ENSMUST00000006112
AA Change: D815G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000006112
Gene: ENSMUSG00000005958
AA Change: D815G

Domain	Start	End	E-Value	Type
low complexity region	6	26	N/A	INTRINSIC
EPH_lbd	31	204	6.47e-126	SMART
Pfam:GCC2_GCC3	269	312	5.8e-9	PFAM
FN3	332	430	8.43e-9	SMART
FN3	448	527	2.72e-12	SMART
Pfam:EphA2_TM	555	625	1e-24	PFAM
TyrKc	628	887	1.35e-134	SMART
SAM	917	984	3.88e-24	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000159575

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000160053

Predicted Effect

probably damaging
Transcript: ENSMUST00000161063
AA Change: D561G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Meta Mutation Damage Score

0.9626

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.0%
20x: 94.2%

Validation Efficiency

97% (60/62)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Ephrin receptors and their ligands, the ephrins, mediate numerous developmental processes, particularly in the nervous system. Based on their structures and sequence relationships, ephrins are divided into the ephrin-A (EFNA) class, which are anchored to the membrane by a glycosylphosphatidylinositol linkage, and the ephrin-B (EFNB) class, which are transmembrane proteins. The Eph family of receptors are divided into two groups based on the similarity of their extracellular domain sequences and their affinities for binding ephrin-A and ephrin-B ligands. Ephrin receptors make up the largest subgroup of the receptor tyrosine kinase (RTK) family. This gene encodes a receptor for ephrin-B family members. [provided by RefSeq, Mar 2010]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit defects in corpus callosum formation and impaired Paneth cell downward migration in the intestinal epithelium, resulting in scattered positioning along crypt and villus. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930402F06Rik	A	G	2: 35,380,396	F98L	probably damaging	Het
Adam26b	T	C	8: 43,520,372	N531S	probably benign	Het
Ahdc1	T	C	4: 133,064,165	S906P	possibly damaging	Het
Ank	A	G	15: 27,544,257	N35D	probably damaging	Het
Ano10	A	G	9: 122,252,928		probably benign	Het
Atp4a	T	C	7: 30,724,952		probably null	Het
C030005K15Rik	T	C	10: 97,725,542	Y109C	unknown	Het
Carmil1	T	A	13: 24,067,223		probably benign	Het
Ccl2	A	G	11: 82,037,059	R110G	probably benign	Het
Cntnap2	C	A	6: 46,856,128	F758L	probably benign	Het
Cog6	A	C	3: 53,002,529	D267E	possibly damaging	Het
Cyp4f37	G	T	17: 32,631,672	E366D	probably benign	Het
Dcun1d4	A	G	5: 73,534,637	D89G	probably damaging	Het
Dpep1	T	C	8: 123,194,153	V24A	probably benign	Het
Eefsec	T	C	6: 88,376,250	I48V	probably benign	Het
Elmo2	G	A	2: 165,294,249	Q195*	probably null	Het
Erich2	C	A	2: 70,512,790		probably benign	Het
Gatm	A	G	2: 122,597,446	V362A	probably damaging	Het
Gdf10	A	G	14: 33,932,615	M360V	probably damaging	Het
Gpr141	T	C	13: 19,751,825	N260S	probably benign	Het
Hectd1	T	A	12: 51,802,436		probably null	Het
Insrr	A	G	3: 87,809,599	E682G	probably benign	Het
Itgax	A	G	7: 128,141,266	I742V	possibly damaging	Het
Kcnh1	T	C	1: 192,276,699	V187A	probably benign	Het
Kdm6b	G	T	11: 69,406,268	S419R	possibly damaging	Het
Kmt2a	A	T	9: 44,836,693		probably benign	Het
Krt10	A	G	11: 99,386,193		probably benign	Het
Lct	G	A	1: 128,285,181	R1912C	probably benign	Het
Lefty1	T	C	1: 180,937,781	S305P	probably benign	Het
Mast3	A	G	8: 70,787,908	L279P	probably damaging	Het
Mfsd4b3	T	C	10: 39,947,347	T306A	probably benign	Het
Mgam	G	A	6: 40,754,902	R1351Q	probably damaging	Het
Mknk1	T	A	4: 115,864,561	F101I	probably damaging	Het
Mlc1	T	C	15: 88,966,494	I154V	probably benign	Het
Myo5b	T	C	18: 74,759,240	I1685T	possibly damaging	Het
Nacc2	T	A	2: 26,060,336	M463L	probably benign	Het
Nek11	A	C	9: 105,244,390	Y443*	probably null	Het
Nme4	T	C	17: 26,094,222		probably null	Het
Nova1	A	G	12: 46,817,018		probably benign	Het
Olfr651	A	T	7: 104,553,323	I135F	possibly damaging	Het
Parp10	A	G	15: 76,241,154		probably null	Het
Pkd1l3	T	A	8: 109,623,971	S483T	possibly damaging	Het
Plce1	T	C	19: 38,524,265	S3P	probably damaging	Het
Pnldc1	T	C	17: 12,890,779	D400G	probably benign	Het
Polr2b	G	A	5: 77,348,405	R1141H	possibly damaging	Het
Prmt6	A	G	3: 110,249,941	I344T	probably damaging	Het
Psmd2	G	A	16: 20,663,205	G896D	probably damaging	Het
Ranbp17	C	T	11: 33,500,718	R73Q	possibly damaging	Het
Rcn1	G	T	2: 105,399,050	Y52*	probably null	Het
Reck	T	C	4: 43,922,931	I402T	probably damaging	Het
Tecpr1	C	A	5: 144,206,259	A735S	probably benign	Het
Tshz1	T	C	18: 84,014,829	K485E	possibly damaging	Het
Ube4a	G	A	9: 44,949,900		probably benign	Het
Vldlr	A	G	19: 27,238,313	T237A	probably benign	Het
Vmn1r74	C	A	7: 11,846,971	T66K	probably damaging	Het
Wdr49	C	A	3: 75,323,665	L563F	probably benign	Het
Zmym1	C	T	4: 127,049,879	V239I	probably benign	Het
Zmym5	T	A	14: 56,797,811	T267S	probably benign	Het

Other mutations in Ephb3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00476:Ephb3	APN	16	21220415	splice site	probably null
IGL00966:Ephb3	APN	16	21217294	missense	probably benign	0.00
IGL02166:Ephb3	APN	16	21220749	missense	probably damaging	1.00
IGL02245:Ephb3	APN	16	21221424	missense	probably benign	0.04
IGL02321:Ephb3	APN	16	21214389	missense	probably damaging	1.00
IGL02337:Ephb3	APN	16	21221503	splice site	probably null
IGL02507:Ephb3	APN	16	21220639	splice site	probably benign
IGL02755:Ephb3	APN	16	21221698	missense	probably damaging	1.00
IGL02806:Ephb3	APN	16	21222281	missense	probably benign	0.02
PIT4362001:Ephb3	UTSW	16	21220857	missense	probably damaging	1.00
R0026:Ephb3	UTSW	16	21214917	missense	probably damaging	1.00
R0194:Ephb3	UTSW	16	21218109	missense	probably benign	0.01
R0196:Ephb3	UTSW	16	21218054	missense	probably damaging	1.00
R0230:Ephb3	UTSW	16	21220775	missense	probably damaging	1.00
R0828:Ephb3	UTSW	16	21219034	unclassified	probably benign
R1126:Ephb3	UTSW	16	21222476	missense	possibly damaging	0.87
R1460:Ephb3	UTSW	16	21218922	missense	probably benign
R1592:Ephb3	UTSW	16	21221700	missense	probably damaging	1.00
R1632:Ephb3	UTSW	16	21212937	missense	probably benign	0.00
R1694:Ephb3	UTSW	16	21221745	missense	probably damaging	1.00
R1719:Ephb3	UTSW	16	21220650	missense	probably damaging	1.00
R1777:Ephb3	UTSW	16	21217235	missense	probably damaging	0.99
R1928:Ephb3	UTSW	16	21222295	missense	possibly damaging	0.86
R1956:Ephb3	UTSW	16	21221382	missense	probably damaging	1.00
R2378:Ephb3	UTSW	16	21218243	missense	probably benign
R3408:Ephb3	UTSW	16	21219504	missense	probably damaging	0.99
R4429:Ephb3	UTSW	16	21214463	missense	probably damaging	1.00
R4655:Ephb3	UTSW	16	21222208	missense	probably damaging	0.98
R4826:Ephb3	UTSW	16	21214995	missense	possibly damaging	0.90
R4828:Ephb3	UTSW	16	21214995	missense	possibly damaging	0.90
R4960:Ephb3	UTSW	16	21220495	missense	probably benign	0.09
R5057:Ephb3	UTSW	16	21220447	missense	probably damaging	1.00
R5090:Ephb3	UTSW	16	21214487	missense	probably damaging	1.00
R5396:Ephb3	UTSW	16	21219105	missense	possibly damaging	0.91
R5540:Ephb3	UTSW	16	21220860	missense	probably damaging	1.00
R5628:Ephb3	UTSW	16	21218119	missense	probably damaging	1.00
R5666:Ephb3	UTSW	16	21222491	missense	probably benign	0.08
R5838:Ephb3	UTSW	16	21221687	missense	probably damaging	1.00
R5866:Ephb3	UTSW	16	21211379	intron	probably benign
R6017:Ephb3	UTSW	16	21222031	missense	probably damaging	1.00
R6020:Ephb3	UTSW	16	21222013	missense	probably damaging	0.99
R6510:Ephb3	UTSW	16	21218111	missense	probably damaging	0.98
R6539:Ephb3	UTSW	16	21221468	missense	probably benign
R6591:Ephb3	UTSW	16	21214473	missense	probably damaging	1.00
R6691:Ephb3	UTSW	16	21214473	missense	probably damaging	1.00
R7101:Ephb3	UTSW	16	21218518	missense	possibly damaging	0.86
R7111:Ephb3	UTSW	16	21218827	nonsense	probably null
R7236:Ephb3	UTSW	16	21214481	missense	probably damaging	1.00
R7307:Ephb3	UTSW	16	21222226	missense	probably benign	0.04
R7410:Ephb3	UTSW	16	21221408	missense	possibly damaging	0.75
R7413:Ephb3	UTSW	16	21214707	missense	probably damaging	1.00
R7452:Ephb3	UTSW	16	21217357	splice site	probably null
R7944:Ephb3	UTSW	16	21221684	missense	probably damaging	1.00
R7945:Ephb3	UTSW	16	21221684	missense	probably damaging	1.00
R9092:Ephb3	UTSW	16	21222464	missense	probably benign	0.01
Z1176:Ephb3	UTSW	16	21218036	missense	possibly damaging	0.53

Predicted Primers

PCR Primer
(F):5'- TGGTACAGGAAGCCTCTGAG -3'
(R):5'- GGTAACCGATAGTCTTGCTCTACAG -3'

Sequencing Primer
(F):5'- TACAGGAAGCCTCTGAGGGATTTG -3'
(R):5'- GCTCTACAGCATTAATGACCTGG -3'

Posted On

2015-04-30