Incidental Mutation 'R4043:Zfpm2'
ID313955
Institutional Source Beutler Lab
Gene Symbol Zfpm2
Ensembl Gene ENSMUSG00000022306
Gene Namezinc finger protein, multitype 2
SynonymsB330005D23Rik, FOG2, FOG-2
MMRRC Submission 041615-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4043 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location40655035-41104592 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 40870627 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 2 (D2V)
Ref Sequence ENSEMBL: ENSMUSP00000155094 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053467] [ENSMUST00000230319]
Predicted Effect possibly damaging
Transcript: ENSMUST00000053467
AA Change: D134V

PolyPhen 2 Score 0.880 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000051335
Gene: ENSMUSG00000022306
AA Change: D134V

DomainStartEndE-ValueType
low complexity region 19 35 N/A INTRINSIC
ZnF_C2H2 250 270 4.27e1 SMART
ZnF_C2H2 296 320 1.25e-1 SMART
ZnF_C2H2 335 357 4.05e-1 SMART
ZnF_C2H2 363 385 6.23e-2 SMART
ZnF_C2H2 548 569 1.43e1 SMART
ZnF_C2H2 687 714 1.06e2 SMART
low complexity region 731 741 N/A INTRINSIC
ZnF_C2H2 854 874 5.4e1 SMART
ZnF_C2H2 1119 1145 4.99e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229777
Predicted Effect possibly damaging
Transcript: ENSMUST00000230319
AA Change: D2V

PolyPhen 2 Score 0.943 (Sensitivity: 0.80; Specificity: 0.95)
Meta Mutation Damage Score 0.3135 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 92.9%
Validation Efficiency 97% (64/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The zinc finger protein encoded by this gene is a widely expressed member of the FOG family of transcription factors. The family members modulate the activity of GATA family proteins, which are important regulators of hematopoiesis and cardiogenesis in mammals. It has been demonstrated that the protein can both activate and down-regulate expression of GATA-target genes, suggesting different modulation in different promoter contexts. A related mRNA suggests an alternatively spliced product but this information is not yet fully supported by the sequence. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit cardiac defects, including absence of coronary vasculature, resulting in lethality between E12.5 and E15.5. Conditional mutations reveal errors in ovary and testis development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4430402I18Rik A T 19: 28,945,783 C80S possibly damaging Het
4930415L06Rik A G X: 89,932,303 F96S probably damaging Het
Adgrf3 T C 5: 30,204,362 N44D probably benign Het
AU018091 A G 7: 3,159,122 F375L probably damaging Het
Bsph1 G T 7: 13,458,276 probably null Het
Casp1 A G 9: 5,302,444 D122G probably benign Het
Ccdc146 C T 5: 21,316,943 C361Y probably benign Het
Cdc37l1 T C 19: 28,990,628 S31P possibly damaging Het
Cdca2 A T 14: 67,704,006 M249K probably benign Het
Cfap73 C T 5: 120,629,965 probably null Het
Cgnl1 A G 9: 71,705,293 L749S probably damaging Het
Cmtr2 C A 8: 110,221,830 C257* probably null Het
Col6a4 A T 9: 106,072,411 L675* probably null Het
Cpne8 A T 15: 90,572,001 D186E probably damaging Het
Csmd3 A G 15: 47,755,966 probably null Het
D330045A20Rik C T X: 139,507,003 S364L probably damaging Het
D430042O09Rik A G 7: 125,868,741 I1366V probably benign Het
Daglb T A 5: 143,487,151 Y354N possibly damaging Het
Dlgap1 T C 17: 70,761,080 S549P probably damaging Het
Dnah11 T C 12: 117,879,943 D4389G probably damaging Het
Dst T A 1: 34,190,684 C2631S probably benign Het
Gimap1 T A 6: 48,743,242 W263R probably damaging Het
Gne A C 4: 44,040,383 C594G possibly damaging Het
Gtf2a1 T C 12: 91,575,667 H47R probably benign Het
Hdac6 T C X: 7,931,492 T993A probably benign Het
Helz2 T C 2: 181,229,710 D2703G probably benign Het
Jmjd1c G A 10: 67,219,466 V222I possibly damaging Het
Kndc1 A G 7: 139,924,129 E1116G probably benign Het
Krt10 C T 11: 99,386,993 probably null Het
Lrrc37a T G 11: 103,498,653 H1982P possibly damaging Het
Med13l T A 5: 118,593,463 L68Q probably damaging Het
Megf10 C A 18: 57,259,798 D422E probably damaging Het
Mpz C T 1: 171,159,771 probably benign Het
Muc5ac A T 7: 141,807,478 T1508S possibly damaging Het
Myo3a C T 2: 22,333,539 probably benign Het
Ndnf A T 6: 65,703,936 N400Y possibly damaging Het
Olfr192 G A 16: 59,098,761 T77I unknown Het
Olfr414 T C 1: 174,431,091 I221T probably damaging Het
Olfr855 G T 9: 19,584,995 V153F probably benign Het
Otol1 A G 3: 70,027,779 D368G probably damaging Het
Pappa A G 4: 65,314,587 N1321S probably benign Het
Patl1 T A 19: 11,942,950 L756Q probably damaging Het
Plcg2 A G 8: 117,612,978 M1043V probably benign Het
Plekhg2 G A 7: 28,364,719 probably benign Het
Ppp2r2d G A 7: 138,882,416 W265* probably null Het
Prss40 G T 1: 34,560,879 S9* probably null Het
Radil T A 5: 142,494,233 I471F probably benign Het
Rpl10l A T 12: 66,284,203 M52K probably damaging Het
Scn1a A T 2: 66,326,036 S510T possibly damaging Het
Sdad1 T G 5: 92,302,694 N194T probably damaging Het
Sel1l3 A T 5: 53,188,054 Y259* probably null Het
Slc22a26 T C 19: 7,788,329 probably null Het
Snap91 C T 9: 86,777,049 G477D probably damaging Het
Srr T C 11: 74,909,121 T202A probably benign Het
Srrm1 C T 4: 135,340,931 probably benign Het
Trp53bp2 T A 1: 182,449,061 L869Q possibly damaging Het
Ttbk1 T A 17: 46,446,762 D982V probably benign Het
Ttn T C 2: 76,794,157 T15324A probably benign Het
Ush1c T C 7: 46,221,528 E276G probably damaging Het
Vcan T A 13: 89,692,543 L1627F probably benign Het
Vps8 A C 16: 21,526,396 D823A probably damaging Het
Zfp616 T A 11: 74,085,282 N792K possibly damaging Het
Zfyve16 A C 13: 92,513,763 probably null Het
Zmym2 T A 14: 56,958,308 probably benign Het
Other mutations in Zfpm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00473:Zfpm2 APN 15 41099287 missense probably damaging 1.00
IGL00815:Zfpm2 APN 15 41099491 missense probably benign 0.37
IGL00821:Zfpm2 APN 15 41103387 missense probably damaging 1.00
IGL01622:Zfpm2 APN 15 41101924 missense probably benign 0.07
IGL01623:Zfpm2 APN 15 41101924 missense probably benign 0.07
IGL01807:Zfpm2 APN 15 40753056 critical splice donor site probably null
IGL01872:Zfpm2 APN 15 41102387 missense probably benign
IGL02087:Zfpm2 APN 15 41103121 missense probably damaging 0.97
IGL02123:Zfpm2 APN 15 41102195 missense probably damaging 1.00
IGL02355:Zfpm2 APN 15 41099494 missense probably damaging 1.00
IGL02362:Zfpm2 APN 15 41099494 missense probably damaging 1.00
IGL02579:Zfpm2 APN 15 41099472 missense possibly damaging 0.91
IGL02752:Zfpm2 APN 15 41102019 missense probably benign 0.23
IGL02792:Zfpm2 APN 15 41103013 missense probably benign 0.00
IGL02861:Zfpm2 APN 15 41103266 missense probably damaging 0.98
IGL03180:Zfpm2 APN 15 41101394 missense probably damaging 1.00
IGL03344:Zfpm2 APN 15 41102774 missense probably benign
R0305:Zfpm2 UTSW 15 40774035 splice site probably benign
R0365:Zfpm2 UTSW 15 40774066 missense possibly damaging 0.88
R1171:Zfpm2 UTSW 15 41101679 missense probably damaging 1.00
R1456:Zfpm2 UTSW 15 41102481 missense probably damaging 1.00
R1482:Zfpm2 UTSW 15 41099291 missense probably damaging 1.00
R1580:Zfpm2 UTSW 15 41103209 missense possibly damaging 0.84
R2119:Zfpm2 UTSW 15 41103023 missense probably damaging 1.00
R2189:Zfpm2 UTSW 15 41101183 missense possibly damaging 0.76
R2867:Zfpm2 UTSW 15 41099389 missense probably benign 0.06
R2867:Zfpm2 UTSW 15 41099389 missense probably benign 0.06
R2886:Zfpm2 UTSW 15 41102323 missense probably benign 0.44
R3024:Zfpm2 UTSW 15 41102959 missense probably benign 0.00
R4178:Zfpm2 UTSW 15 41103544 missense probably damaging 1.00
R4465:Zfpm2 UTSW 15 41096161 missense probably benign 0.00
R5263:Zfpm2 UTSW 15 41099395 missense probably benign 0.45
R5266:Zfpm2 UTSW 15 41099469 missense probably benign 0.01
R5352:Zfpm2 UTSW 15 40870542 missense probably benign 0.01
R5584:Zfpm2 UTSW 15 41102537 missense probably benign 0.45
R5661:Zfpm2 UTSW 15 41096071 nonsense probably null
R6437:Zfpm2 UTSW 15 41099397 missense probably benign
R6660:Zfpm2 UTSW 15 40655585 critical splice donor site probably null
R6742:Zfpm2 UTSW 15 41101718 missense probably benign
R6749:Zfpm2 UTSW 15 40954708 missense possibly damaging 0.90
R7363:Zfpm2 UTSW 15 40753017 missense probably damaging 1.00
R7401:Zfpm2 UTSW 15 41102990 missense possibly damaging 0.87
R7657:Zfpm2 UTSW 15 41103275 missense possibly damaging 0.78
R7690:Zfpm2 UTSW 15 40954766 missense possibly damaging 0.45
R7698:Zfpm2 UTSW 15 41096091 missense probably benign 0.03
R7893:Zfpm2 UTSW 15 41102612 missense probably damaging 1.00
R7976:Zfpm2 UTSW 15 41102612 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAAATGCAAAACCGGTGTTATTG -3'
(R):5'- CAGATACGGCGGGTAAGTTAC -3'

Sequencing Primer
(F):5'- ATGCAAAACCGGTGTTATTGTTAGG -3'
(R):5'- GGTAAGTTACCTCACTAGTCAACC -3'
Posted On2015-04-30