Mutagenetix > Incidental Mutations

Incidental Mutation 'R4043:Zfpm2'

313955

Institutional Source

Beutler Lab

Gene Symbol

Zfpm2

Ensembl Gene

ENSMUSG00000022306

Gene Name

zinc finger protein, multitype 2

Synonyms

B330005D23Rik, FOG2, FOG-2

MMRRC Submission

041615-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R4043 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

40655035-41104592 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 40870627 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Valine at position 2 (D2V)

Ref Sequence

ENSEMBL: ENSMUSP00000155094 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000053467] [ENSMUST00000230319]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000053467
AA Change: D134V

PolyPhen 2 Score 0.880 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000051335
Gene: ENSMUSG00000022306
AA Change: D134V

Domain	Start	End	E-Value	Type
low complexity region	19	35	N/A	INTRINSIC
ZnF_C2H2	250	270	4.27e1	SMART
ZnF_C2H2	296	320	1.25e-1	SMART
ZnF_C2H2	335	357	4.05e-1	SMART
ZnF_C2H2	363	385	6.23e-2	SMART
ZnF_C2H2	548	569	1.43e1	SMART
ZnF_C2H2	687	714	1.06e2	SMART
low complexity region	731	741	N/A	INTRINSIC
ZnF_C2H2	854	874	5.4e1	SMART
ZnF_C2H2	1119	1145	4.99e1	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000229777

Predicted Effect

possibly damaging
Transcript: ENSMUST00000230319
AA Change: D2V

PolyPhen 2 Score 0.943 (Sensitivity: 0.80; Specificity: 0.95)

Meta Mutation Damage Score

0.3135

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.7%
20x: 92.9%

Validation Efficiency

97% (64/66)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The zinc finger protein encoded by this gene is a widely expressed member of the FOG family of transcription factors. The family members modulate the activity of GATA family proteins, which are important regulators of hematopoiesis and cardiogenesis in mammals. It has been demonstrated that the protein can both activate and down-regulate expression of GATA-target genes, suggesting different modulation in different promoter contexts. A related mRNA suggests an alternatively spliced product but this information is not yet fully supported by the sequence. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit cardiac defects, including absence of coronary vasculature, resulting in lethality between E12.5 and E15.5. Conditional mutations reveal errors in ovary and testis development. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4430402I18Rik	A	T	19: 28,945,783	C80S	possibly damaging	Het
4930415L06Rik	A	G	X: 89,932,303	F96S	probably damaging	Het
Adgrf3	T	C	5: 30,204,362	N44D	probably benign	Het
AU018091	A	G	7: 3,159,122	F375L	probably damaging	Het
Bsph1	G	T	7: 13,458,276		probably null	Het
Casp1	A	G	9: 5,302,444	D122G	probably benign	Het
Ccdc146	C	T	5: 21,316,943	C361Y	probably benign	Het
Cdc37l1	T	C	19: 28,990,628	S31P	possibly damaging	Het
Cdca2	A	T	14: 67,704,006	M249K	probably benign	Het
Cfap73	C	T	5: 120,629,965		probably null	Het
Cgnl1	A	G	9: 71,705,293	L749S	probably damaging	Het
Cmtr2	C	A	8: 110,221,830	C257*	probably null	Het
Col6a4	A	T	9: 106,072,411	L675*	probably null	Het
Cpne8	A	T	15: 90,572,001	D186E	probably damaging	Het
Csmd3	A	G	15: 47,755,966		probably null	Het
D330045A20Rik	C	T	X: 139,507,003	S364L	probably damaging	Het
D430042O09Rik	A	G	7: 125,868,741	I1366V	probably benign	Het
Daglb	T	A	5: 143,487,151	Y354N	possibly damaging	Het
Dlgap1	T	C	17: 70,761,080	S549P	probably damaging	Het
Dnah11	T	C	12: 117,879,943	D4389G	probably damaging	Het
Dst	T	A	1: 34,190,684	C2631S	probably benign	Het
Gimap1	T	A	6: 48,743,242	W263R	probably damaging	Het
Gne	A	C	4: 44,040,383	C594G	possibly damaging	Het
Gtf2a1	T	C	12: 91,575,667	H47R	probably benign	Het
Hdac6	T	C	X: 7,931,492	T993A	probably benign	Het
Helz2	T	C	2: 181,229,710	D2703G	probably benign	Het
Jmjd1c	G	A	10: 67,219,466	V222I	possibly damaging	Het
Kndc1	A	G	7: 139,924,129	E1116G	probably benign	Het
Krt10	C	T	11: 99,386,993		probably null	Het
Lrrc37a	T	G	11: 103,498,653	H1982P	possibly damaging	Het
Med13l	T	A	5: 118,593,463	L68Q	probably damaging	Het
Megf10	C	A	18: 57,259,798	D422E	probably damaging	Het
Mpz	C	T	1: 171,159,771		probably benign	Het
Muc5ac	A	T	7: 141,807,478	T1508S	possibly damaging	Het
Myo3a	C	T	2: 22,333,539		probably benign	Het
Ndnf	A	T	6: 65,703,936	N400Y	possibly damaging	Het
Olfr192	G	A	16: 59,098,761	T77I	unknown	Het
Olfr414	T	C	1: 174,431,091	I221T	probably damaging	Het
Olfr855	G	T	9: 19,584,995	V153F	probably benign	Het
Otol1	A	G	3: 70,027,779	D368G	probably damaging	Het
Pappa	A	G	4: 65,314,587	N1321S	probably benign	Het
Patl1	T	A	19: 11,942,950	L756Q	probably damaging	Het
Plcg2	A	G	8: 117,612,978	M1043V	probably benign	Het
Plekhg2	G	A	7: 28,364,719		probably benign	Het
Ppp2r2d	G	A	7: 138,882,416	W265*	probably null	Het
Prss40	G	T	1: 34,560,879	S9*	probably null	Het
Radil	T	A	5: 142,494,233	I471F	probably benign	Het
Rpl10l	A	T	12: 66,284,203	M52K	probably damaging	Het
Scn1a	A	T	2: 66,326,036	S510T	possibly damaging	Het
Sdad1	T	G	5: 92,302,694	N194T	probably damaging	Het
Sel1l3	A	T	5: 53,188,054	Y259*	probably null	Het
Slc22a26	T	C	19: 7,788,329		probably null	Het
Snap91	C	T	9: 86,777,049	G477D	probably damaging	Het
Srr	T	C	11: 74,909,121	T202A	probably benign	Het
Srrm1	C	T	4: 135,340,931		probably benign	Het
Trp53bp2	T	A	1: 182,449,061	L869Q	possibly damaging	Het
Ttbk1	T	A	17: 46,446,762	D982V	probably benign	Het
Ttn	T	C	2: 76,794,157	T15324A	probably benign	Het
Ush1c	T	C	7: 46,221,528	E276G	probably damaging	Het
Vcan	T	A	13: 89,692,543	L1627F	probably benign	Het
Vps8	A	C	16: 21,526,396	D823A	probably damaging	Het
Zfp616	T	A	11: 74,085,282	N792K	possibly damaging	Het
Zfyve16	A	C	13: 92,513,763		probably null	Het
Zmym2	T	A	14: 56,958,308		probably benign	Het

Other mutations in Zfpm2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00473:Zfpm2	APN	15	41099287	missense	probably damaging	1.00
IGL00815:Zfpm2	APN	15	41099491	missense	probably benign	0.37
IGL00821:Zfpm2	APN	15	41103387	missense	probably damaging	1.00
IGL01622:Zfpm2	APN	15	41101924	missense	probably benign	0.07
IGL01623:Zfpm2	APN	15	41101924	missense	probably benign	0.07
IGL01807:Zfpm2	APN	15	40753056	critical splice donor site	probably null
IGL01872:Zfpm2	APN	15	41102387	missense	probably benign
IGL02087:Zfpm2	APN	15	41103121	missense	probably damaging	0.97
IGL02123:Zfpm2	APN	15	41102195	missense	probably damaging	1.00
IGL02355:Zfpm2	APN	15	41099494	missense	probably damaging	1.00
IGL02362:Zfpm2	APN	15	41099494	missense	probably damaging	1.00
IGL02579:Zfpm2	APN	15	41099472	missense	possibly damaging	0.91
IGL02752:Zfpm2	APN	15	41102019	missense	probably benign	0.23
IGL02792:Zfpm2	APN	15	41103013	missense	probably benign	0.00
IGL02861:Zfpm2	APN	15	41103266	missense	probably damaging	0.98
IGL03180:Zfpm2	APN	15	41101394	missense	probably damaging	1.00
IGL03344:Zfpm2	APN	15	41102774	missense	probably benign
R0305:Zfpm2	UTSW	15	40774035	splice site	probably benign
R0365:Zfpm2	UTSW	15	40774066	missense	possibly damaging	0.88
R1171:Zfpm2	UTSW	15	41101679	missense	probably damaging	1.00
R1456:Zfpm2	UTSW	15	41102481	missense	probably damaging	1.00
R1482:Zfpm2	UTSW	15	41099291	missense	probably damaging	1.00
R1580:Zfpm2	UTSW	15	41103209	missense	possibly damaging	0.84
R2119:Zfpm2	UTSW	15	41103023	missense	probably damaging	1.00
R2189:Zfpm2	UTSW	15	41101183	missense	possibly damaging	0.76
R2867:Zfpm2	UTSW	15	41099389	missense	probably benign	0.06
R2867:Zfpm2	UTSW	15	41099389	missense	probably benign	0.06
R2886:Zfpm2	UTSW	15	41102323	missense	probably benign	0.44
R3024:Zfpm2	UTSW	15	41102959	missense	probably benign	0.00
R4178:Zfpm2	UTSW	15	41103544	missense	probably damaging	1.00
R4465:Zfpm2	UTSW	15	41096161	missense	probably benign	0.00
R5263:Zfpm2	UTSW	15	41099395	missense	probably benign	0.45
R5266:Zfpm2	UTSW	15	41099469	missense	probably benign	0.01
R5352:Zfpm2	UTSW	15	40870542	missense	probably benign	0.01
R5584:Zfpm2	UTSW	15	41102537	missense	probably benign	0.45
R5661:Zfpm2	UTSW	15	41096071	nonsense	probably null
R6437:Zfpm2	UTSW	15	41099397	missense	probably benign
R6660:Zfpm2	UTSW	15	40655585	critical splice donor site	probably null
R6742:Zfpm2	UTSW	15	41101718	missense	probably benign
R6749:Zfpm2	UTSW	15	40954708	missense	possibly damaging	0.90
R7363:Zfpm2	UTSW	15	40753017	missense	probably damaging	1.00
R7401:Zfpm2	UTSW	15	41102990	missense	possibly damaging	0.87
R7657:Zfpm2	UTSW	15	41103275	missense	possibly damaging	0.78
R7690:Zfpm2	UTSW	15	40954766	missense	possibly damaging	0.45
R7698:Zfpm2	UTSW	15	41096091	missense	probably benign	0.03
R7893:Zfpm2	UTSW	15	41102612	missense	probably damaging	1.00
R7976:Zfpm2	UTSW	15	41102612	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCAAATGCAAAACCGGTGTTATTG -3'
(R):5'- CAGATACGGCGGGTAAGTTAC -3'

Sequencing Primer
(F):5'- ATGCAAAACCGGTGTTATTGTTAGG -3'
(R):5'- GGTAAGTTACCTCACTAGTCAACC -3'

Posted On

2015-04-30