Mutagenetix > Incidental Mutation

Incidental Mutation 'R1763:Sema4g'

193240

Institutional Source

Beutler Lab

Gene Symbol

Sema4g

Ensembl Gene

ENSMUSG00000025207

Gene Name

sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4G

Synonyms

MMRRC Submission

039795-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1763 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

44989101-45003397 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

C to T at 45001605 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Stop codon at position 708 (R708*)

Ref Sequence

ENSEMBL: ENSMUSP00000137395 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000026225] [ENSMUST00000026227] [ENSMUST00000097715] [ENSMUST00000130549] [ENSMUST00000179305]

AlphaFold

Q9WUH7

Predicted Effect

probably null
Transcript: ENSMUST00000026225
AA Change: R708*

SMART Domains

Protein: ENSMUSP00000026225
Gene: ENSMUSG00000025207
AA Change: R708*

Domain	Start	End	E-Value	Type
signal peptide	1	17	N/A	INTRINSIC
Sema	56	487	2.38e-165	SMART
PSI	505	556	6.59e-13	SMART
IG	567	649	6.26e-5	SMART
low complexity region	650	666	N/A	INTRINSIC
transmembrane domain	677	699	N/A	INTRINSIC
low complexity region	701	708	N/A	INTRINSIC
low complexity region	713	720	N/A	INTRINSIC
low complexity region	734	751	N/A	INTRINSIC
low complexity region	761	774	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000026227

SMART Domains

Protein: ENSMUSP00000026227
Gene: ENSMUSG00000025209

Domain	Start	End	E-Value	Type
low complexity region	213	224	N/A	INTRINSIC
Blast:TOPRIM	260	331	8e-16	BLAST
Pfam:AAA_25	377	565	5.6e-25	PFAM
Pfam:DnaB_C	390	631	6.7e-17	PFAM
Pfam:KaiC	394	628	2.6e-11	PFAM
low complexity region	650	661	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000097715

SMART Domains

Protein: ENSMUSP00000095322
Gene: ENSMUSG00000025208

Domain	Start	End	E-Value	Type
L51_S25_CI-B8	35	108	1.61e-23	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000130549
AA Change: R708*

SMART Domains

Protein: ENSMUSP00000138321
Gene: ENSMUSG00000025207
AA Change: R708*

Domain	Start	End	E-Value	Type
signal peptide	1	17	N/A	INTRINSIC
Sema	56	487	2.38e-165	SMART
PSI	505	556	6.59e-13	SMART
IG	567	649	6.26e-5	SMART
low complexity region	650	666	N/A	INTRINSIC
transmembrane domain	677	699	N/A	INTRINSIC
low complexity region	701	708	N/A	INTRINSIC
low complexity region	713	720	N/A	INTRINSIC
low complexity region	734	751	N/A	INTRINSIC
low complexity region	761	774	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000179305
AA Change: R708*

SMART Domains

Protein: ENSMUSP00000137395
Gene: ENSMUSG00000025207
AA Change: R708*

Domain	Start	End	E-Value	Type
signal peptide	1	17	N/A	INTRINSIC
Sema	56	487	2.38e-165	SMART
PSI	505	556	6.59e-13	SMART
IG	567	649	6.26e-5	SMART
low complexity region	650	666	N/A	INTRINSIC
transmembrane domain	677	699	N/A	INTRINSIC
low complexity region	701	708	N/A	INTRINSIC
low complexity region	713	720	N/A	INTRINSIC
low complexity region	734	751	N/A	INTRINSIC
low complexity region	761	774	N/A	INTRINSIC

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 97.4%
3x: 96.8%
10x: 95.1%
20x: 92.0%

Validation Efficiency

98% (85/87)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Semaphorins are a large family of conserved secreted and membrane associated proteins which possess a semaphorin (Sema) domain and a PSI domain (found in plexins, semaphorins and integrins) in the N-terminal extracellular portion. Based on sequence and structural similarities, semaphorins are put into eight classes: invertebrates contain classes 1 and 2, viruses have class V, and vertebrates contain classes 3-7. Semaphorins serve as axon guidance ligands via multimeric receptor complexes, some (if not all) containing plexin proteins. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2011]
PHENOTYPE: Mice homozygous for a targeted allele exhibit normal cerebellar morphology. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 82 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca4	G	A	3: 122,110,681	V794M	probably benign	Het
Abca4	A	T	3: 122,163,830	T772S	probably damaging	Het
Acox3	G	A	5: 35,608,339		probably null	Het
Adamts17	A	G	7: 67,147,715	N1060S	probably damaging	Het
Akap8l	C	T	17: 32,332,483	R511H	probably damaging	Het
Als2	T	C	1: 59,174,991	Y1346C	probably benign	Het
Apol10b	A	T	15: 77,585,015	F321I	probably benign	Het
Atp5f1	A	G	3: 105,951,589		probably null	Het
Bloc1s5	A	G	13: 38,619,084		probably benign	Het
Btbd9	T	C	17: 30,334,297	N397S	possibly damaging	Het
Cacna1d	A	G	14: 30,099,196	V1121A	probably benign	Het
Cad	G	A	5: 31,060,951	V460I	probably damaging	Het
Caprin2	A	T	6: 148,843,121	D935E	probably damaging	Het
Ccdc150	A	T	1: 54,354,636	K686N	probably benign	Het
Ccnt2	T	C	1: 127,799,406	F186L	possibly damaging	Het
Cd5l	G	A	3: 87,367,880		probably null	Het
Chrna7	A	G	7: 63,099,252	V494A	probably benign	Het
Clec2i	T	G	6: 128,895,425	Y198*	probably null	Het
Col22a1	A	G	15: 72,007,176	V44A	probably damaging	Het
Cspg4	T	A	9: 56,886,979	I666N	probably damaging	Het
Cyp3a16	A	T	5: 145,465,031		probably null	Het
Dlk1	G	T	12: 109,458,119	C102F	probably damaging	Het
Dscc1	T	A	15: 55,084,139	H215L	probably damaging	Het
Dscc1	CTGAATGAAT	CTGAAT	15: 55,080,176		probably benign	Het
Dus1l	C	G	11: 120,795,671	G15R	probably benign	Het
Eps8l1	G	T	7: 4,471,823	V268L	probably benign	Het
F2	A	C	2: 91,634,906	C104W	probably damaging	Het
F5	C	A	1: 164,192,535	Q860K	probably benign	Het
Fmn2	T	C	1: 174,502,266	L74P	unknown	Het
Frmd6	G	A	12: 70,893,622	R347Q	possibly damaging	Het
Gabbr1	T	G	17: 37,054,767	S158A	probably damaging	Het
Galc	T	C	12: 98,234,266	N295S	probably damaging	Het
Gm436	A	G	4: 144,669,959	V401A	probably benign	Het
Gm6408	A	T	5: 146,482,322	N49I	probably damaging	Het
Grm1	T	A	10: 11,079,866	T225S	possibly damaging	Het
Grm8	C	T	6: 27,285,867	V849I	possibly damaging	Het
Hmcn2	A	G	2: 31,314,590	D59G	probably damaging	Het
Iars	G	A	13: 49,723,077		probably null	Het
Ifi27	C	T	12: 103,437,682	A127V	possibly damaging	Het
Ikbip	A	G	10: 91,096,481	N329S	probably damaging	Het
Ikbke	T	C	1: 131,265,877	T479A	probably benign	Het
Krt12	T	A	11: 99,416,060	N472I	probably damaging	Het
Lmnb2	A	T	10: 80,907,191	L193Q	probably damaging	Het
Lrriq4	T	C	3: 30,650,252	V128A	probably benign	Het
Map4k4	C	A	1: 40,000,757		probably benign	Het
Mtmr7	T	C	8: 40,551,811	T575A	probably benign	Het
Myh13	G	A	11: 67,334,576	A256T	probably benign	Het
Napepld	A	G	5: 21,683,410	Y14H	probably benign	Het
Npr1	T	C	3: 90,459,337	T552A	probably damaging	Het
Nudt15	A	G	14: 73,521,647	F127S	probably benign	Het
Nwd2	T	A	5: 63,808,271	S1733T	probably benign	Het
Olfr1189	A	G	2: 88,592,436	I211V	probably benign	Het
Olfr1257	G	A	2: 89,881,129	G101E	probably damaging	Het
Olfr1348	T	G	7: 6,501,441	I262L	probably benign	Het
Olfr907	A	G	9: 38,499,038	Y123C	probably damaging	Het
Olfr96	T	C	17: 37,225,430	F102L	probably benign	Het
Paqr7	A	T	4: 134,507,098	I89F	probably benign	Het
Pidd1	C	A	7: 141,439,630	V706L	probably benign	Het
Polr3c	A	T	3: 96,713,595	I469N	probably damaging	Het
Ppip5k1	A	G	2: 121,348,547	Y233H	probably damaging	Het
Psmc3	A	G	2: 91,055,995	T166A	possibly damaging	Het
Ptchd3	A	T	11: 121,842,542	I753L	probably benign	Het
Rad21	T	C	15: 51,978,170	K50R	probably damaging	Het
Rad54b	A	G	4: 11,604,989	E479G	possibly damaging	Het
Rfwd3	C	T	8: 111,288,242	R326Q	probably damaging	Het
Rgs20	C	T	1: 4,910,640	R154Q	probably damaging	Het
Sbf1	T	C	15: 89,294,425	D1449G	probably damaging	Het
Sept9	T	C	11: 117,290,428	I18T	probably benign	Het
Serpinb6b	A	G	13: 32,978,058	E280G	probably damaging	Het
Slamf6	T	C	1: 171,942,587		probably benign	Het
Slc6a21	G	A	7: 45,287,734	W554*	probably null	Het
Slco1a4	A	C	6: 141,812,731	I518R	probably benign	Het
Stab1	T	A	14: 31,168,416	Q26L	probably benign	Het
Stox1	A	G	10: 62,667,965	F104L	probably damaging	Het
Suco	T	C	1: 161,834,949	K638E	possibly damaging	Het
Synpo	T	C	18: 60,602,784	K458E	probably damaging	Het
Szt2	A	T	4: 118,372,368	W2820R	unknown	Het
Tmtc1	C	A	6: 148,294,618	G499W	probably damaging	Het
Tonsl	A	C	15: 76,638,066	S242R	probably damaging	Het
Trpc4	G	T	3: 54,194,822	S47I	possibly damaging	Het
Zfp106	G	A	2: 120,520,428	R1581C	probably benign	Het
Zfp27	A	G	7: 29,895,376	L388P	possibly damaging	Het

Other mutations in Sema4g

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01414:Sema4g	APN	19	44997996	missense	probably damaging	1.00
IGL01419:Sema4g	APN	19	44997396	missense	probably benign	0.00
IGL02033:Sema4g	APN	19	44997415	missense	probably damaging	1.00
IGL02092:Sema4g	APN	19	44992639	critical splice donor site	probably null
IGL02148:Sema4g	APN	19	44996469	missense	probably damaging	1.00
IGL02829:Sema4g	APN	19	44992749	missense	possibly damaging	0.95
IGL02837:Sema4g	UTSW	19	44996711	missense	probably damaging	0.96
R0550:Sema4g	UTSW	19	44997665	missense	probably benign
R0675:Sema4g	UTSW	19	44997587	missense	probably damaging	1.00
R1202:Sema4g	UTSW	19	44998257	missense	probably benign	0.31
R1346:Sema4g	UTSW	19	44997652	missense	possibly damaging	0.65
R1533:Sema4g	UTSW	19	44992817	missense	probably damaging	1.00
R1775:Sema4g	UTSW	19	44999242	critical splice donor site	probably null
R1803:Sema4g	UTSW	19	44998020	missense	probably benign	0.05
R1832:Sema4g	UTSW	19	44999017	missense	probably benign
R1909:Sema4g	UTSW	19	44997622	missense	probably damaging	0.96
R4035:Sema4g	UTSW	19	45001414	missense	probably damaging	0.99
R4131:Sema4g	UTSW	19	44998919	missense	probably benign
R4611:Sema4g	UTSW	19	45001612	missense	probably damaging	1.00
R4951:Sema4g	UTSW	19	44996571	splice site	probably null
R5921:Sema4g	UTSW	19	44998704	missense	probably benign	0.04
R7573:Sema4g	UTSW	19	44997571	missense	probably damaging	0.96
R8099:Sema4g	UTSW	19	44992528	missense	probably damaging	1.00
R8169:Sema4g	UTSW	19	44998971	missense	probably damaging	1.00
R8354:Sema4g	UTSW	19	44998427	missense	probably benign	0.01
R8980:Sema4g	UTSW	19	44993144	missense	probably benign	0.04
R9158:Sema4g	UTSW	19	44998407	missense	possibly damaging	0.88
R9487:Sema4g	UTSW	19	44992632	missense	probably benign	0.00
X0011:Sema4g	UTSW	19	44998869	splice site	probably null
Z1177:Sema4g	UTSW	19	44998047	missense	probably benign	0.03
Z1177:Sema4g	UTSW	19	45001881	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ATGGCTGCTATGCCGAGGAGAATG -3'
(R):5'- GCCTCAGGAGCACATAACTGTTGC -3'

Sequencing Primer
(F):5'- AGAATGGCCTCCGTATGCTG -3'
(R):5'- GTCAGCTCAGCgggtgg -3'

Posted On

2014-05-23