Incidental Mutation 'R2061:Hivep1'
ID 316290
Institutional Source Beutler Lab
Gene Symbol Hivep1
Ensembl Gene ENSMUSG00000021366
Gene Name human immunodeficiency virus type I enhancer binding protein 1
Synonyms Cryabp1, alphaA-CRYBP1
MMRRC Submission 040066-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.494) question?
Stock # R2061 (G1)
Quality Score 225
Status Validated
Chromosome 13
Chromosomal Location 42205304-42338504 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 42313600 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Glutamic Acid at position 1947 (K1947E)
Ref Sequence ENSEMBL: ENSMUSP00000056147 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060148]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000060148
AA Change: K1947E

PolyPhen 2 Score 0.795 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000056147
Gene: ENSMUSG00000021366
AA Change: K1947E

DomainStartEndE-ValueType
coiled coil region 10 36 N/A INTRINSIC
low complexity region 177 194 N/A INTRINSIC
low complexity region 355 371 N/A INTRINSIC
low complexity region 376 388 N/A INTRINSIC
ZnF_C2H2 407 429 4.79e-3 SMART
ZnF_C2H2 435 457 1.95e-3 SMART
low complexity region 488 504 N/A INTRINSIC
low complexity region 595 609 N/A INTRINSIC
low complexity region 844 854 N/A INTRINSIC
ZnF_C2H2 953 980 1.53e2 SMART
low complexity region 1253 1271 N/A INTRINSIC
low complexity region 1275 1307 N/A INTRINSIC
low complexity region 1585 1608 N/A INTRINSIC
low complexity region 1902 1912 N/A INTRINSIC
ZnF_C2H2 2074 2096 2.24e-3 SMART
ZnF_C2H2 2102 2126 1.5e-4 SMART
low complexity region 2164 2183 N/A INTRINSIC
low complexity region 2299 2313 N/A INTRINSIC
low complexity region 2345 2365 N/A INTRINSIC
low complexity region 2517 2527 N/A INTRINSIC
low complexity region 2580 2594 N/A INTRINSIC
low complexity region 2629 2642 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222491
Predicted Effect probably benign
Transcript: ENSMUST00000222854
Meta Mutation Damage Score 0.3114 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 99% (124/125)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcription factor belonging to the ZAS family, members of which are large proteins that contain a ZAS domain - a modular protein structure consisting of a pair of C2H2 zinc fingers with an acidic-rich region and a serine/threonine-rich sequence. These proteins bind specifically to the DNA sequence motif, GGGACTTTCC, found in the enhancer elements of several viral promoters, including human immunodeficiency virus (HIV), and to related sequences found in the enhancer elements of a number of cellular promoters. This protein binds to this sequence motif, suggesting a role in the transcriptional regulation of both viral and cellular genes. [provided by RefSeq, Oct 2011]
Allele List at MGI
Other mutations in this stock
Total: 122 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A4gnt T C 9: 99,502,412 (GRCm39) S191P probably damaging Het
Ak2 C T 4: 128,901,990 (GRCm39) A221V probably damaging Het
Akap9 T A 5: 4,011,010 (GRCm39) V571E probably damaging Het
Amph G T 13: 19,309,205 (GRCm39) E428* probably null Het
Armh3 C T 19: 45,967,106 (GRCm39) R12Q probably damaging Het
Arnt2 T A 7: 83,993,078 (GRCm39) D154V probably damaging Het
Arrdc1 G A 2: 24,816,364 (GRCm39) Q202* probably null Het
Ate1 A G 7: 130,112,643 (GRCm39) C72R probably damaging Het
Atox1 A G 11: 55,345,724 (GRCm39) V22A possibly damaging Het
Bbs12 A T 3: 37,373,215 (GRCm39) M3L probably damaging Het
Bfsp1 A G 2: 143,704,598 (GRCm39) V85A probably benign Het
Bltp2 T A 11: 78,159,575 (GRCm39) C541* probably null Het
Caskin2 C A 11: 115,694,456 (GRCm39) V382F probably benign Het
Ccdc39 T A 3: 33,874,045 (GRCm39) M596L probably damaging Het
Cd22 C T 7: 30,569,530 (GRCm39) V529M probably damaging Het
Cd22 A C 7: 30,575,581 (GRCm39) Y154D probably benign Het
Cdadc1 T A 14: 59,818,783 (GRCm39) E348D probably damaging Het
Cdhr2 T C 13: 54,868,631 (GRCm39) V531A probably damaging Het
Cdk11b A G 4: 155,726,061 (GRCm39) probably benign Het
Cebpa G T 7: 34,818,947 (GRCm39) R35L probably damaging Het
Chat T C 14: 32,168,830 (GRCm39) N235S probably benign Het
Col12a1 T A 9: 79,524,987 (GRCm39) I2725F possibly damaging Het
Cracr2b A G 7: 141,045,193 (GRCm39) E231G probably damaging Het
Cryaa G T 17: 31,900,029 (GRCm39) A151S probably benign Het
Cspg4b T A 13: 113,454,628 (GRCm39) W225R probably damaging Het
Dab1 A T 4: 104,535,938 (GRCm39) I116F probably damaging Het
Ddx43 C A 9: 78,303,386 (GRCm39) N75K probably benign Het
Dmbt1 T G 7: 130,700,863 (GRCm39) C1014G possibly damaging Het
Dner C A 1: 84,383,710 (GRCm39) C558F probably damaging Het
Dsc2 A G 18: 20,165,456 (GRCm39) V839A possibly damaging Het
Dsg3 C T 18: 20,660,794 (GRCm39) R378* probably null Het
Ecpas G T 4: 58,824,270 (GRCm39) P1116T probably damaging Het
Emilin1 C T 5: 31,075,082 (GRCm39) P441L possibly damaging Het
Epha6 T C 16: 59,476,160 (GRCm39) M1069V probably damaging Het
F930017D23Rik A C 10: 43,480,416 (GRCm39) noncoding transcript Het
Faf1 A T 4: 109,568,005 (GRCm39) N22Y probably damaging Het
Flrt3 A T 2: 140,503,373 (GRCm39) V85E probably damaging Het
Gadl1 T A 9: 115,770,448 (GRCm39) I87N probably damaging Het
Galnt14 A G 17: 73,819,148 (GRCm39) F314S probably damaging Het
Gba2 A T 4: 43,574,029 (GRCm39) Y141* probably null Het
Gdap1 A T 1: 17,215,689 (GRCm39) probably benign Het
Gfod1 A T 13: 43,456,719 (GRCm39) probably null Het
Gm14295 C T 2: 176,502,474 (GRCm39) R655* probably null Het
Gm4353 A G 7: 115,682,934 (GRCm39) S216P probably damaging Het
Gm6605 T A 7: 38,147,706 (GRCm39) noncoding transcript Het
Hectd1 A T 12: 51,841,227 (GRCm39) D634E probably damaging Het
Helz2 A G 2: 180,882,337 (GRCm39) I152T probably damaging Het
Ifrd1 A T 12: 40,263,244 (GRCm39) F144L probably benign Het
Inhca T C 9: 103,145,513 (GRCm39) M395V probably benign Het
Itgae A T 11: 73,009,448 (GRCm39) Q544L probably benign Het
Jmjd1c A T 10: 67,054,205 (GRCm39) E323D probably damaging Het
Kdm5a G T 6: 120,358,578 (GRCm39) R207L probably benign Het
Kif5b C T 18: 6,226,377 (GRCm39) probably null Het
Lbp T C 2: 158,166,499 (GRCm39) V351A probably benign Het
Lss A T 10: 76,381,932 (GRCm39) probably null Het
Madd A C 2: 90,991,831 (GRCm39) probably benign Het
Map6 G A 7: 98,966,679 (GRCm39) V503I probably damaging Het
Mark1 A G 1: 184,660,260 (GRCm39) L22P probably damaging Het
Mcfd2 T C 17: 87,563,404 (GRCm39) N130D probably damaging Het
Mcm3ap A G 10: 76,305,902 (GRCm39) N5S probably benign Het
Mdm4 A T 1: 132,940,389 (GRCm39) F48I probably damaging Het
Mga A T 2: 119,795,461 (GRCm39) probably benign Het
Mknk2 A T 10: 80,507,391 (GRCm39) probably null Het
Mmp15 T C 8: 96,097,407 (GRCm39) Y459H possibly damaging Het
Mthfd1l A G 10: 4,053,288 (GRCm39) K879R probably benign Het
Mycbp2 T C 14: 103,524,696 (GRCm39) K655E probably damaging Het
Nasp T C 4: 116,468,323 (GRCm39) N221D probably benign Het
Ndc80 T C 17: 71,821,213 (GRCm39) E245G probably benign Het
Nmral1 C T 16: 4,534,193 (GRCm39) E83K probably damaging Het
Noa1 T A 5: 77,452,034 (GRCm39) Q550L possibly damaging Het
Nutm1 A T 2: 112,086,097 (GRCm39) Y211* probably null Het
Or10n1 G T 9: 39,525,071 (GRCm39) M69I probably benign Het
Or10v1 T A 19: 11,873,921 (GRCm39) Y179N probably damaging Het
Or2ag18 A C 7: 106,404,975 (GRCm39) H231Q probably benign Het
Or4l1 T C 14: 50,166,478 (GRCm39) I174M possibly damaging Het
Or5b118 A G 19: 13,448,605 (GRCm39) I90M probably damaging Het
Otoa T C 7: 120,730,551 (GRCm39) F584L probably damaging Het
Palb2 G A 7: 121,723,748 (GRCm39) T304I possibly damaging Het
Pcolce2 A T 9: 95,552,229 (GRCm39) M121L probably benign Het
Pcsk5 T C 19: 17,432,236 (GRCm39) T1460A probably benign Het
Pdzrn4 A T 15: 92,668,041 (GRCm39) D731V probably damaging Het
Pex11b C A 3: 96,543,037 (GRCm39) Q12K possibly damaging Het
Pigw G C 11: 84,768,136 (GRCm39) Q398E probably benign Het
Pkd1 A G 17: 24,788,888 (GRCm39) E882G possibly damaging Het
Pkhd1 A T 1: 20,683,036 (GRCm39) N55K possibly damaging Het
Plch2 A T 4: 155,127,298 (GRCm39) probably benign Het
Plcl1 T A 1: 55,790,504 (GRCm39) L1058Q probably benign Het
Ppfia2 T C 10: 106,673,190 (GRCm39) S511P possibly damaging Het
Ppfibp2 T C 7: 107,338,437 (GRCm39) L676P probably damaging Het
Ppp6c T G 2: 39,116,186 (GRCm39) D23A probably damaging Het
Prss30 G A 17: 24,193,642 (GRCm39) probably benign Het
Ptprz1 T C 6: 23,049,674 (GRCm39) probably null Het
Rec114 T A 9: 58,560,188 (GRCm39) probably benign Het
Ryr2 T C 13: 11,680,764 (GRCm39) probably null Het
Ryr3 A T 2: 112,493,349 (GRCm39) I3715N possibly damaging Het
Scin T C 12: 40,130,947 (GRCm39) Y322C probably damaging Het
Scn3a A G 2: 65,291,652 (GRCm39) V1698A probably damaging Het
Scn5a G A 9: 119,314,717 (GRCm39) S1996L probably damaging Het
Serpinb2 A G 1: 107,450,525 (GRCm39) K174R possibly damaging Het
Slc16a4 T C 3: 107,208,027 (GRCm39) I179T probably benign Het
Slc35b1 T G 11: 95,276,718 (GRCm39) F102V possibly damaging Het
Slc66a2 G T 18: 80,334,930 (GRCm39) A232S probably benign Het
Slc6a15 A G 10: 103,245,595 (GRCm39) D526G probably benign Het
Spata16 A G 3: 26,978,519 (GRCm39) D495G probably damaging Het
Stk11ip G A 1: 75,506,228 (GRCm39) E583K possibly damaging Het
Stk-ps1 T G 17: 36,709,044 (GRCm39) noncoding transcript Het
Sufu T A 19: 46,385,651 (GRCm39) I37N probably damaging Het
Tacr1 C T 6: 82,469,535 (GRCm39) P140S probably damaging Het
Tas1r3 G A 4: 155,944,927 (GRCm39) R765C probably damaging Het
Tenm3 C T 8: 48,795,291 (GRCm39) probably null Het
Tex36 A T 7: 133,196,952 (GRCm39) I55N probably damaging Het
Tmem150c T C 5: 100,227,887 (GRCm39) Y192C probably damaging Het
Tmem237 A G 1: 59,159,445 (GRCm39) probably benign Het
Trim11 A G 11: 58,872,889 (GRCm39) E191G probably damaging Het
Ttll3 C T 6: 113,386,003 (GRCm39) A612V possibly damaging Het
Ttn G A 2: 76,807,466 (GRCm39) A89V probably damaging Het
Usp37 A G 1: 74,507,431 (GRCm39) F529L probably damaging Het
Vmn1r217 A C 13: 23,298,698 (GRCm39) V68G probably benign Het
Vwf T C 6: 125,568,151 (GRCm39) S349P probably damaging Het
Wt1 G A 2: 104,961,502 (GRCm39) probably null Het
Zcchc7 T A 4: 44,895,838 (GRCm39) L262H probably damaging Het
Zfp873 A G 10: 81,895,991 (GRCm39) S241G probably benign Het
Other mutations in Hivep1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00530:Hivep1 APN 13 42,308,125 (GRCm39) missense probably benign 0.00
IGL00572:Hivep1 APN 13 42,312,347 (GRCm39) missense probably benign 0.00
IGL00820:Hivep1 APN 13 42,337,294 (GRCm39) missense probably benign 0.29
IGL00846:Hivep1 APN 13 42,321,092 (GRCm39) nonsense probably null
IGL01068:Hivep1 APN 13 42,313,460 (GRCm39) missense probably benign 0.00
IGL01431:Hivep1 APN 13 42,311,493 (GRCm39) missense probably damaging 0.96
IGL01664:Hivep1 APN 13 42,312,755 (GRCm39) missense probably benign 0.18
IGL01833:Hivep1 APN 13 42,308,464 (GRCm39) nonsense probably null
IGL02037:Hivep1 APN 13 42,309,553 (GRCm39) missense probably benign 0.00
IGL02375:Hivep1 APN 13 42,309,925 (GRCm39) missense probably benign 0.30
IGL02414:Hivep1 APN 13 42,308,385 (GRCm39) missense probably damaging 0.99
IGL02609:Hivep1 APN 13 42,309,130 (GRCm39) missense probably damaging 0.98
IGL02649:Hivep1 APN 13 42,310,787 (GRCm39) missense possibly damaging 0.69
IGL02654:Hivep1 APN 13 42,311,161 (GRCm39) missense probably damaging 0.97
IGL02977:Hivep1 APN 13 42,309,412 (GRCm39) missense possibly damaging 0.94
IGL03124:Hivep1 APN 13 42,312,380 (GRCm39) missense possibly damaging 0.66
IGL03050:Hivep1 UTSW 13 42,309,604 (GRCm39) missense probably benign 0.12
PIT4305001:Hivep1 UTSW 13 42,335,147 (GRCm39) missense
R0067:Hivep1 UTSW 13 42,312,132 (GRCm39) missense probably benign 0.00
R0067:Hivep1 UTSW 13 42,312,132 (GRCm39) missense probably benign 0.00
R0078:Hivep1 UTSW 13 42,309,517 (GRCm39) missense probably damaging 1.00
R0194:Hivep1 UTSW 13 42,308,911 (GRCm39) missense probably damaging 1.00
R0195:Hivep1 UTSW 13 42,309,629 (GRCm39) missense probably benign
R0245:Hivep1 UTSW 13 42,317,766 (GRCm39) missense possibly damaging 0.93
R0348:Hivep1 UTSW 13 42,311,855 (GRCm39) missense possibly damaging 0.65
R0654:Hivep1 UTSW 13 42,313,232 (GRCm39) missense probably benign 0.16
R0655:Hivep1 UTSW 13 42,321,061 (GRCm39) missense probably damaging 1.00
R0717:Hivep1 UTSW 13 42,308,422 (GRCm39) missense possibly damaging 0.46
R1013:Hivep1 UTSW 13 42,310,438 (GRCm39) missense probably damaging 1.00
R1216:Hivep1 UTSW 13 42,310,997 (GRCm39) missense probably benign 0.03
R1256:Hivep1 UTSW 13 42,335,307 (GRCm39) missense probably damaging 1.00
R1435:Hivep1 UTSW 13 42,311,519 (GRCm39) missense probably damaging 1.00
R1437:Hivep1 UTSW 13 42,310,616 (GRCm39) missense probably benign 0.03
R1438:Hivep1 UTSW 13 42,311,596 (GRCm39) missense probably benign 0.00
R1672:Hivep1 UTSW 13 42,313,760 (GRCm39) missense probably damaging 0.96
R1733:Hivep1 UTSW 13 42,311,407 (GRCm39) missense probably damaging 1.00
R1762:Hivep1 UTSW 13 42,337,262 (GRCm39) missense possibly damaging 0.80
R1786:Hivep1 UTSW 13 42,337,262 (GRCm39) missense possibly damaging 0.80
R1909:Hivep1 UTSW 13 42,309,122 (GRCm39) missense probably benign 0.38
R1993:Hivep1 UTSW 13 42,310,969 (GRCm39) missense probably benign 0.00
R2004:Hivep1 UTSW 13 42,313,625 (GRCm39) missense possibly damaging 0.47
R2069:Hivep1 UTSW 13 42,337,262 (GRCm39) missense possibly damaging 0.80
R2075:Hivep1 UTSW 13 42,309,794 (GRCm39) missense probably damaging 0.98
R2076:Hivep1 UTSW 13 42,317,869 (GRCm39) critical splice donor site probably null
R2085:Hivep1 UTSW 13 42,337,226 (GRCm39) missense probably benign 0.34
R3701:Hivep1 UTSW 13 42,311,203 (GRCm39) missense probably benign 0.03
R3702:Hivep1 UTSW 13 42,311,203 (GRCm39) missense probably benign 0.03
R3716:Hivep1 UTSW 13 42,311,971 (GRCm39) missense probably damaging 1.00
R3718:Hivep1 UTSW 13 42,311,971 (GRCm39) missense probably damaging 1.00
R3719:Hivep1 UTSW 13 42,311,203 (GRCm39) missense probably benign 0.03
R3720:Hivep1 UTSW 13 42,312,077 (GRCm39) missense probably benign 0.01
R3820:Hivep1 UTSW 13 42,337,787 (GRCm39) missense possibly damaging 0.46
R3822:Hivep1 UTSW 13 42,337,787 (GRCm39) missense possibly damaging 0.46
R3842:Hivep1 UTSW 13 42,311,203 (GRCm39) missense probably benign 0.03
R4379:Hivep1 UTSW 13 42,308,906 (GRCm39) missense probably damaging 1.00
R4525:Hivep1 UTSW 13 42,309,289 (GRCm39) missense probably benign
R4587:Hivep1 UTSW 13 42,309,704 (GRCm39) missense probably benign 0.00
R4604:Hivep1 UTSW 13 42,313,225 (GRCm39) missense probably benign 0.08
R4686:Hivep1 UTSW 13 42,309,326 (GRCm39) missense probably benign 0.00
R4725:Hivep1 UTSW 13 42,316,887 (GRCm39) missense probably benign 0.19
R4924:Hivep1 UTSW 13 42,311,792 (GRCm39) missense probably benign 0.20
R5009:Hivep1 UTSW 13 42,312,229 (GRCm39) missense probably benign 0.06
R5320:Hivep1 UTSW 13 42,313,115 (GRCm39) missense probably damaging 1.00
R5385:Hivep1 UTSW 13 42,317,871 (GRCm39) splice site probably null
R5498:Hivep1 UTSW 13 42,276,634 (GRCm39) critical splice acceptor site probably null
R5521:Hivep1 UTSW 13 42,311,804 (GRCm39) missense probably damaging 1.00
R5529:Hivep1 UTSW 13 42,310,126 (GRCm39) missense possibly damaging 0.81
R5584:Hivep1 UTSW 13 42,313,593 (GRCm39) missense probably benign
R5635:Hivep1 UTSW 13 42,313,603 (GRCm39) missense probably benign 0.16
R5636:Hivep1 UTSW 13 42,316,932 (GRCm39) missense possibly damaging 0.92
R5886:Hivep1 UTSW 13 42,310,088 (GRCm39) missense probably damaging 1.00
R5895:Hivep1 UTSW 13 42,310,694 (GRCm39) missense possibly damaging 0.95
R5981:Hivep1 UTSW 13 42,313,664 (GRCm39) missense probably damaging 1.00
R6012:Hivep1 UTSW 13 42,337,934 (GRCm39) missense possibly damaging 0.50
R6033:Hivep1 UTSW 13 42,310,583 (GRCm39) missense probably benign 0.20
R6033:Hivep1 UTSW 13 42,310,583 (GRCm39) missense probably benign 0.20
R6037:Hivep1 UTSW 13 42,311,416 (GRCm39) missense probably damaging 1.00
R6037:Hivep1 UTSW 13 42,311,416 (GRCm39) missense probably damaging 1.00
R6241:Hivep1 UTSW 13 42,311,846 (GRCm39) missense probably benign 0.01
R6247:Hivep1 UTSW 13 42,310,966 (GRCm39) missense probably benign
R6343:Hivep1 UTSW 13 42,313,147 (GRCm39) nonsense probably null
R6631:Hivep1 UTSW 13 42,309,956 (GRCm39) missense probably damaging 0.96
R6720:Hivep1 UTSW 13 42,317,760 (GRCm39) missense probably damaging 1.00
R6767:Hivep1 UTSW 13 42,308,203 (GRCm39) missense probably damaging 0.99
R6797:Hivep1 UTSW 13 42,310,557 (GRCm39) missense probably benign 0.00
R6800:Hivep1 UTSW 13 42,310,852 (GRCm39) missense probably damaging 1.00
R6854:Hivep1 UTSW 13 42,309,983 (GRCm39) missense probably damaging 1.00
R6919:Hivep1 UTSW 13 42,336,928 (GRCm39) missense probably benign 0.00
R6993:Hivep1 UTSW 13 42,312,190 (GRCm39) missense possibly damaging 0.94
R7104:Hivep1 UTSW 13 42,310,814 (GRCm39) missense probably benign 0.26
R7139:Hivep1 UTSW 13 42,313,430 (GRCm39) missense probably benign 0.28
R7186:Hivep1 UTSW 13 42,309,814 (GRCm39) missense probably benign 0.01
R7227:Hivep1 UTSW 13 42,310,387 (GRCm39) missense probably benign 0.02
R7263:Hivep1 UTSW 13 42,311,668 (GRCm39) missense possibly damaging 0.50
R7438:Hivep1 UTSW 13 42,308,387 (GRCm39) missense probably damaging 0.99
R7490:Hivep1 UTSW 13 42,311,126 (GRCm39) missense probably damaging 1.00
R7583:Hivep1 UTSW 13 42,317,716 (GRCm39) missense probably damaging 1.00
R7708:Hivep1 UTSW 13 42,317,753 (GRCm39) nonsense probably null
R7763:Hivep1 UTSW 13 42,312,937 (GRCm39) missense probably benign 0.12
R7840:Hivep1 UTSW 13 42,308,828 (GRCm39) missense probably benign
R7864:Hivep1 UTSW 13 42,312,290 (GRCm39) missense probably benign 0.02
R7913:Hivep1 UTSW 13 42,309,842 (GRCm39) missense probably benign 0.00
R7934:Hivep1 UTSW 13 42,308,174 (GRCm39) missense probably benign 0.17
R8017:Hivep1 UTSW 13 42,321,098 (GRCm39) missense
R8019:Hivep1 UTSW 13 42,321,098 (GRCm39) missense
R8312:Hivep1 UTSW 13 42,308,653 (GRCm39) missense possibly damaging 0.80
R8336:Hivep1 UTSW 13 42,309,405 (GRCm39) missense probably benign 0.00
R8415:Hivep1 UTSW 13 42,308,905 (GRCm39) missense probably benign 0.20
R8477:Hivep1 UTSW 13 42,337,696 (GRCm39) missense probably benign 0.00
R8868:Hivep1 UTSW 13 42,312,407 (GRCm39) missense possibly damaging 0.82
R9015:Hivep1 UTSW 13 42,311,849 (GRCm39) missense probably benign 0.34
R9185:Hivep1 UTSW 13 42,337,975 (GRCm39) missense possibly damaging 0.86
R9225:Hivep1 UTSW 13 42,337,184 (GRCm39) missense probably damaging 1.00
R9330:Hivep1 UTSW 13 42,317,713 (GRCm39) missense probably damaging 1.00
R9364:Hivep1 UTSW 13 42,308,251 (GRCm39) missense possibly damaging 0.63
R9377:Hivep1 UTSW 13 42,335,403 (GRCm39) missense probably benign 0.13
R9422:Hivep1 UTSW 13 42,313,213 (GRCm39) missense probably benign 0.06
R9451:Hivep1 UTSW 13 42,337,252 (GRCm39) missense probably benign 0.00
R9480:Hivep1 UTSW 13 42,337,058 (GRCm39) missense probably damaging 1.00
R9490:Hivep1 UTSW 13 42,311,518 (GRCm39) missense probably damaging 0.96
R9502:Hivep1 UTSW 13 42,322,779 (GRCm39) missense
R9554:Hivep1 UTSW 13 42,308,251 (GRCm39) missense possibly damaging 0.63
X0060:Hivep1 UTSW 13 42,308,461 (GRCm39) missense probably benign 0.07
X0067:Hivep1 UTSW 13 42,310,193 (GRCm39) missense probably damaging 0.98
Z1177:Hivep1 UTSW 13 42,313,457 (GRCm39) missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- GAAAGTGCCTGTGTTTTGCC -3'
(R):5'- TCCACTTGCTTGAATAGACCAC -3'

Sequencing Primer
(F):5'- TCGCCAGGGGTTAGACATG -3'
(R):5'- CCACTAAATCTGATTTTGAATGGGTG -3'
Posted On 2015-05-15