Incidental Mutation 'R4076:Tm2d3'
ID 316561
Institutional Source Beutler Lab
Gene Symbol Tm2d3
Ensembl Gene ENSMUSG00000078681
Gene Name TM2 domain containing 3
Synonyms
MMRRC Submission 040975-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R4076 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 65691169-65701913 bp(+) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) T to A at 65697750 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Stop codon at position 49 (L49*)
Ref Sequence ENSEMBL: ENSMUSP00000145545 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032726] [ENSMUST00000065574] [ENSMUST00000107495] [ENSMUST00000129166] [ENSMUST00000143508] [ENSMUST00000206517] [ENSMUST00000206628] [ENSMUST00000206934]
AlphaFold Q8BJ83
Predicted Effect probably damaging
Transcript: ENSMUST00000032726
AA Change: C111S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000032726
Gene: ENSMUSG00000078681
AA Change: C111S

DomainStartEndE-ValueType
low complexity region 8 22 N/A INTRINSIC
Pfam:TM2 165 214 5.1e-17 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000065574
AA Change: C142S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000064967
Gene: ENSMUSG00000078681
AA Change: C142S

DomainStartEndE-ValueType
low complexity region 8 22 N/A INTRINSIC
Pfam:TM2 196 245 6.3e-17 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000107495
AA Change: C142S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103119
Gene: ENSMUSG00000078681
AA Change: C142S

DomainStartEndE-ValueType
low complexity region 8 22 N/A INTRINSIC
Pfam:TM2 196 245 5e-17 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000129166
AA Change: C142S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000143508
SMART Domains Protein: ENSMUSP00000116848
Gene: ENSMUSG00000078681

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000206361
AA Change: C85S
Predicted Effect probably damaging
Transcript: ENSMUST00000206517
AA Change: C133S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000206628
AA Change: C113S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000206837
Predicted Effect probably null
Transcript: ENSMUST00000206934
AA Change: L49*
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains a structural module related to that of the seven transmembrane domain G protein-coupled receptor superfamily. This protein has sequence and structural similarities to the beta-amyloid binding protein (BBP), but, unlike BBP, it does not regulate a response to beta-amyloid peptide. This protein may have regulatory roles in cell death or proliferation signal cascades. Several alternatively spliced transcript variants of this gene are described but the full length nature of some variants has not been determined. Multiple polyadenylation sites have been found in this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm4 T A 7: 119,698,758 (GRCm38) L206H probably benign Het
Anxa5 T C 3: 36,450,380 (GRCm38) I277V probably benign Het
Atg12 A G 18: 46,737,424 (GRCm38) F92L probably benign Het
Cd48 T A 1: 171,695,883 (GRCm38) V98D probably damaging Het
Dnah11 A G 12: 118,045,678 (GRCm38) M2083T probably benign Het
Dnah9 T C 11: 66,084,904 (GRCm38) T1440A probably benign Het
Dnali1 T C 4: 125,059,470 (GRCm38) D188G probably damaging Het
Dst A G 1: 34,192,269 (GRCm38) E2656G probably benign Het
Eps15l1 A G 8: 72,380,284 (GRCm38) I482T probably damaging Het
Ercc4 G A 16: 13,130,685 (GRCm38) V499I probably damaging Het
Eva1c T A 16: 90,904,131 (GRCm38) F331Y probably damaging Het
Fcho1 T C 8: 71,710,369 (GRCm38) H672R probably damaging Het
Fras1 G C 5: 96,743,158 (GRCm38) D2849H probably damaging Het
Gm5346 A T 8: 43,626,350 (GRCm38) F279Y probably damaging Het
Hdc C T 2: 126,616,261 (GRCm38) R47Q possibly damaging Het
Ighv1-30 C T 12: 114,817,401 (GRCm38) noncoding transcript Het
Krtap31-1 T C 11: 99,908,232 (GRCm38) I87T possibly damaging Het
Lamp3 A G 16: 19,700,716 (GRCm38) L239P possibly damaging Het
Ltb4r2 A T 14: 55,762,941 (GRCm38) R340W probably benign Het
Map10 T C 8: 125,671,845 (GRCm38) V659A probably benign Het
Nars2 T A 7: 96,958,094 (GRCm38) S91T probably damaging Het
Nlrp4c A G 7: 6,072,710 (GRCm38) K667E probably benign Het
Obox3 G T 7: 15,625,799 (GRCm38) T315N possibly damaging Het
Olfr1469 G A 19: 13,410,935 (GRCm38) R122H possibly damaging Het
Olfr670 A T 7: 104,960,716 (GRCm38) N5K probably damaging Het
Osgin1 A C 8: 119,445,033 (GRCm38) S189R possibly damaging Het
Pidd1 A G 7: 141,440,826 (GRCm38) F453L probably damaging Het
Pik3c2g A T 6: 139,852,863 (GRCm38) N373I probably damaging Het
Pou2f2 T C 7: 25,097,288 (GRCm38) T270A probably damaging Het
Rad51b T G 12: 79,314,882 (GRCm38) S122R probably damaging Het
Rev1 T G 1: 38,054,238 (GRCm38) K1075T possibly damaging Het
Rrbp1 T G 2: 143,963,110 (GRCm38) Q1045P probably benign Het
Scg2 A C 1: 79,436,857 (GRCm38) F50V probably damaging Het
Slco1a5 A T 6: 142,268,224 (GRCm38) I57K possibly damaging Het
Tfb1m T A 17: 3,521,670 (GRCm38) R257W probably damaging Het
Usp31 A G 7: 121,667,782 (GRCm38) probably null Het
Zbtb11 C T 16: 55,998,064 (GRCm38) T617I possibly damaging Het
Zfp608 A T 18: 54,898,108 (GRCm38) V920E probably damaging Het
Other mutations in Tm2d3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01338:Tm2d3 APN 7 65,695,222 (GRCm38) nonsense probably null
IGL02312:Tm2d3 APN 7 65,699,169 (GRCm38) critical splice donor site probably null
topple UTSW 7 65,699,124 (GRCm38) missense probably damaging 1.00
R0115:Tm2d3 UTSW 7 65,695,334 (GRCm38) intron probably benign
R0265:Tm2d3 UTSW 7 65,697,834 (GRCm38) missense possibly damaging 0.60
R2143:Tm2d3 UTSW 7 65,695,239 (GRCm38) missense probably damaging 1.00
R4072:Tm2d3 UTSW 7 65,697,750 (GRCm38) nonsense probably null
R4074:Tm2d3 UTSW 7 65,697,750 (GRCm38) nonsense probably null
R4075:Tm2d3 UTSW 7 65,697,750 (GRCm38) nonsense probably null
R4351:Tm2d3 UTSW 7 65,695,191 (GRCm38) missense probably damaging 1.00
R4966:Tm2d3 UTSW 7 65,697,721 (GRCm38) missense possibly damaging 0.81
R5381:Tm2d3 UTSW 7 65,701,672 (GRCm38) missense probably damaging 1.00
R5571:Tm2d3 UTSW 7 65,699,124 (GRCm38) missense probably damaging 1.00
R5621:Tm2d3 UTSW 7 65,701,618 (GRCm38) missense probably damaging 1.00
R6819:Tm2d3 UTSW 7 65,697,778 (GRCm38) missense probably damaging 1.00
R7168:Tm2d3 UTSW 7 65,693,926 (GRCm38) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCCCCTCGATGCTACATACG -3'
(R):5'- AATGTAGTTCTCAAGTGTGGCTAAGG -3'

Sequencing Primer
(F):5'- CGATGCTACATACGAGCCTTC -3'
(R):5'- TAAGGGCTCCCGAGTAAGCTC -3'
Posted On 2015-05-15