Incidental Mutation 'R4076:Tm2d3'
ID 316561
Institutional Source Beutler Lab
Gene Symbol Tm2d3
Ensembl Gene ENSMUSG00000078681
Gene Name TM2 domain containing 3
Synonyms
MMRRC Submission 040975-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R4076 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 65691169-65701913 bp(+) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) T to A at 65697750 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Stop codon at position 49 (L49*)
Ref Sequence ENSEMBL: ENSMUSP00000145545 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032726] [ENSMUST00000065574] [ENSMUST00000107495] [ENSMUST00000129166] [ENSMUST00000143508] [ENSMUST00000206517] [ENSMUST00000206628] [ENSMUST00000206934]
AlphaFold Q8BJ83
Predicted Effect probably damaging
Transcript: ENSMUST00000032726
AA Change: C111S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000032726
Gene: ENSMUSG00000078681
AA Change: C111S

DomainStartEndE-ValueType
low complexity region 8 22 N/A INTRINSIC
Pfam:TM2 165 214 5.1e-17 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000065574
AA Change: C142S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000064967
Gene: ENSMUSG00000078681
AA Change: C142S

DomainStartEndE-ValueType
low complexity region 8 22 N/A INTRINSIC
Pfam:TM2 196 245 6.3e-17 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000107495
AA Change: C142S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103119
Gene: ENSMUSG00000078681
AA Change: C142S

DomainStartEndE-ValueType
low complexity region 8 22 N/A INTRINSIC
Pfam:TM2 196 245 5e-17 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000129166
AA Change: C142S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000143508
SMART Domains Protein: ENSMUSP00000116848
Gene: ENSMUSG00000078681

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000206361
AA Change: C85S
Predicted Effect probably damaging
Transcript: ENSMUST00000206517
AA Change: C133S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000206628
AA Change: C113S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000206837
Predicted Effect probably null
Transcript: ENSMUST00000206934
AA Change: L49*
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains a structural module related to that of the seven transmembrane domain G protein-coupled receptor superfamily. This protein has sequence and structural similarities to the beta-amyloid binding protein (BBP), but, unlike BBP, it does not regulate a response to beta-amyloid peptide. This protein may have regulatory roles in cell death or proliferation signal cascades. Several alternatively spliced transcript variants of this gene are described but the full length nature of some variants has not been determined. Multiple polyadenylation sites have been found in this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm4 T A 7: 119,698,758 L206H probably benign Het
Anxa5 T C 3: 36,450,380 I277V probably benign Het
Atg12 A G 18: 46,737,424 F92L probably benign Het
Cd48 T A 1: 171,695,883 V98D probably damaging Het
Dnah11 A G 12: 118,045,678 M2083T probably benign Het
Dnah9 T C 11: 66,084,904 T1440A probably benign Het
Dnali1 T C 4: 125,059,470 D188G probably damaging Het
Dst A G 1: 34,192,269 E2656G probably benign Het
Eps15l1 A G 8: 72,380,284 I482T probably damaging Het
Ercc4 G A 16: 13,130,685 V499I probably damaging Het
Eva1c T A 16: 90,904,131 F331Y probably damaging Het
Fcho1 T C 8: 71,710,369 H672R probably damaging Het
Fras1 G C 5: 96,743,158 D2849H probably damaging Het
Gm5346 A T 8: 43,626,350 F279Y probably damaging Het
Hdc C T 2: 126,616,261 R47Q possibly damaging Het
Ighv1-30 C T 12: 114,817,401 noncoding transcript Het
Krtap31-1 T C 11: 99,908,232 I87T possibly damaging Het
Lamp3 A G 16: 19,700,716 L239P possibly damaging Het
Ltb4r2 A T 14: 55,762,941 R340W probably benign Het
Map10 T C 8: 125,671,845 V659A probably benign Het
Nars2 T A 7: 96,958,094 S91T probably damaging Het
Nlrp4c A G 7: 6,072,710 K667E probably benign Het
Obox3 G T 7: 15,625,799 T315N possibly damaging Het
Olfr1469 G A 19: 13,410,935 R122H possibly damaging Het
Olfr670 A T 7: 104,960,716 N5K probably damaging Het
Osgin1 A C 8: 119,445,033 S189R possibly damaging Het
Pidd1 A G 7: 141,440,826 F453L probably damaging Het
Pik3c2g A T 6: 139,852,863 N373I probably damaging Het
Pou2f2 T C 7: 25,097,288 T270A probably damaging Het
Rad51b T G 12: 79,314,882 S122R probably damaging Het
Rev1 T G 1: 38,054,238 K1075T possibly damaging Het
Rrbp1 T G 2: 143,963,110 Q1045P probably benign Het
Scg2 A C 1: 79,436,857 F50V probably damaging Het
Slco1a5 A T 6: 142,268,224 I57K possibly damaging Het
Tfb1m T A 17: 3,521,670 R257W probably damaging Het
Usp31 A G 7: 121,667,782 probably null Het
Zbtb11 C T 16: 55,998,064 T617I possibly damaging Het
Zfp608 A T 18: 54,898,108 V920E probably damaging Het
Other mutations in Tm2d3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01338:Tm2d3 APN 7 65695222 nonsense probably null
IGL02312:Tm2d3 APN 7 65699169 critical splice donor site probably null
topple UTSW 7 65699124 missense probably damaging 1.00
R0115:Tm2d3 UTSW 7 65695334 intron probably benign
R0265:Tm2d3 UTSW 7 65697834 missense possibly damaging 0.60
R2143:Tm2d3 UTSW 7 65695239 missense probably damaging 1.00
R4072:Tm2d3 UTSW 7 65697750 nonsense probably null
R4074:Tm2d3 UTSW 7 65697750 nonsense probably null
R4075:Tm2d3 UTSW 7 65697750 nonsense probably null
R4351:Tm2d3 UTSW 7 65695191 missense probably damaging 1.00
R4966:Tm2d3 UTSW 7 65697721 missense possibly damaging 0.81
R5381:Tm2d3 UTSW 7 65701672 missense probably damaging 1.00
R5571:Tm2d3 UTSW 7 65699124 missense probably damaging 1.00
R5621:Tm2d3 UTSW 7 65701618 missense probably damaging 1.00
R6819:Tm2d3 UTSW 7 65697778 missense probably damaging 1.00
R7168:Tm2d3 UTSW 7 65693926 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCCCCTCGATGCTACATACG -3'
(R):5'- AATGTAGTTCTCAAGTGTGGCTAAGG -3'

Sequencing Primer
(F):5'- CGATGCTACATACGAGCCTTC -3'
(R):5'- TAAGGGCTCCCGAGTAAGCTC -3'
Posted On 2015-05-15