Incidental Mutation 'R4087:Fermt3'
ID317442
Institutional Source Beutler Lab
Gene Symbol Fermt3
Ensembl Gene ENSMUSG00000024965
Gene Namefermitin family member 3
SynonymsKindlin-3, C79673
MMRRC Submission 040980-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4087 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location6998958-7019469 bp(-) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) T to A at 7003577 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000037858 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040772] [ENSMUST00000088223]
Predicted Effect probably null
Transcript: ENSMUST00000040772
SMART Domains Protein: ENSMUSP00000037858
Gene: ENSMUSG00000024965

DomainStartEndE-ValueType
Blast:B41 14 77 6e-32 BLAST
B41 94 556 1.66e-28 SMART
PH 350 455 2.26e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000088223
SMART Domains Protein: ENSMUSP00000085555
Gene: ENSMUSG00000047656

DomainStartEndE-ValueType
Pfam:PTS_2-RNA 21 198 2.6e-67 PFAM
Meta Mutation Damage Score 0.9591 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.7%
  • 20x: 96.3%
Validation Efficiency 96% (50/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Kindlins are a small family of proteins that mediate protein-protein interactions involved in integrin activation and thereby have a role in cell adhesion, migration, differentiation, and proliferation. The protein encoded by this gene has a key role in the regulation of hemostasis and thrombosis. This protein may also help maintain the membrane skeleton of erythrocytes. Mutations in this gene cause the autosomal recessive leukocyte adhesion deficiency syndrome-III (LAD-III). Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Jan 2010]
PHENOTYPE: Disruption of this marker results in lethality in the first week after birth, abnormal erythropoiesis and platelet function, and severe hemorrhage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A530064D06Rik A G 17: 48,166,510 S80P probably damaging Het
Acss3 T G 10: 107,053,452 Y169S probably damaging Het
Cep250 G A 2: 155,992,632 R2159K probably damaging Het
Cldn34c4 A T X: 127,721,388 V153E probably damaging Het
Col4a4 T A 1: 82,523,922 Y370F unknown Het
Col6a6 A T 9: 105,783,956 I318N possibly damaging Het
Csmd1 T A 8: 15,992,738 I2332F probably damaging Het
Dnajc28 G A 16: 91,616,867 T187M probably damaging Het
Dym T A 18: 75,230,101 Y559N probably damaging Het
Eif3g A G 9: 20,897,952 V59A possibly damaging Het
Fam171a1 G A 2: 3,226,296 R697Q probably damaging Het
Git2 A G 5: 114,764,405 Y189H probably damaging Het
Gkn3 C T 6: 87,383,525 A163T probably damaging Het
Gm7713 C T 15: 59,994,409 noncoding transcript Het
Gpr108 A G 17: 57,237,925 Y313H probably damaging Het
Kcnh8 T C 17: 52,803,400 I213T possibly damaging Het
Lpgat1 A T 1: 191,763,616 I306F possibly damaging Het
Mapk8 T C 14: 33,390,248 T228A probably benign Het
Med12l T C 3: 59,297,921 V2101A probably benign Het
Mettl13 T C 1: 162,548,202 K19E possibly damaging Het
Mta1 A G 12: 113,112,182 Y22C probably damaging Het
Notch3 T C 17: 32,158,113 T273A possibly damaging Het
Notch4 T C 17: 34,584,435 W1443R probably damaging Het
Npy5r T A 8: 66,682,045 D32V probably damaging Het
Olfr1083-ps C A 2: 86,606,953 *206L probably null Het
Rbm47 A G 5: 66,022,737 M409T probably benign Het
Rnf144a C T 12: 26,327,592 V51I probably damaging Het
Rxfp1 T A 3: 79,644,949 T682S probably damaging Het
Sertad2 GCCCC GCCCCC 11: 20,648,664 probably null Het
Sos1 A G 17: 80,449,352 V257A probably benign Het
Ssfa2 C T 2: 79,658,347 Q925* probably null Het
Tdrd9 C T 12: 112,013,486 Q256* probably null Het
Tmprss11d A T 5: 86,309,279 S174T probably damaging Het
Tor1b T A 2: 30,956,519 I238N probably damaging Het
Tppp2 T C 14: 51,919,500 probably null Het
Traf3ip3 A G 1: 193,181,320 V414A probably damaging Het
Trim14 T A 4: 46,523,709 T110S probably benign Het
Trim30d T C 7: 104,487,800 N66D probably damaging Het
Usp48 A G 4: 137,623,340 N46S possibly damaging Het
Vmn2r115 A C 17: 23,346,384 Q415P probably benign Het
Wbp2nl A G 15: 82,308,561 M149V probably benign Het
Zfp106 T C 2: 120,526,899 probably null Het
Zfp281 T A 1: 136,626,121 I279N probably damaging Het
Other mutations in Fermt3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01160:Fermt3 APN 19 7003258 splice site probably null
IGL01724:Fermt3 APN 19 7001775 missense probably damaging 0.99
IGL01748:Fermt3 APN 19 7003466 critical splice donor site probably null
IGL02392:Fermt3 APN 19 7018815 missense probably benign 0.35
IGL02956:Fermt3 APN 19 7002344 missense probably benign 0.40
IGL03146:Fermt3 APN 19 7003263 missense possibly damaging 0.88
IGL03216:Fermt3 APN 19 6999380 missense probably benign 0.00
P0026:Fermt3 UTSW 19 7014424 missense probably damaging 0.99
R0180:Fermt3 UTSW 19 7002343 missense possibly damaging 0.76
R0445:Fermt3 UTSW 19 7003299 missense probably benign 0.29
R1202:Fermt3 UTSW 19 7003482 missense probably damaging 1.00
R1475:Fermt3 UTSW 19 7018874 splice site probably null
R1668:Fermt3 UTSW 19 7018692 missense probably damaging 1.00
R2179:Fermt3 UTSW 19 7014414 missense probably benign 0.14
R2311:Fermt3 UTSW 19 7014162 missense probably damaging 0.97
R3976:Fermt3 UTSW 19 7002424 missense possibly damaging 0.74
R4667:Fermt3 UTSW 19 7002920 missense probably damaging 1.00
R6108:Fermt3 UTSW 19 7014414 missense probably benign 0.14
R6452:Fermt3 UTSW 19 7014737 missense probably benign 0.00
R6994:Fermt3 UTSW 19 6999727 missense probably damaging 1.00
R7334:Fermt3 UTSW 19 7003038 missense probably benign 0.03
R7357:Fermt3 UTSW 19 7002843 missense probably benign
Z1177:Fermt3 UTSW 19 7014679 missense probably benign 0.29
Predicted Primers PCR Primer
(F):5'- GAAATGGACCTACTTCTGGGAG -3'
(R):5'- GCACTTCATTCAGGGGTAGTC -3'

Sequencing Primer
(F):5'- GGAGGCCTTTTGACCCTGTAC -3'
(R):5'- CTGTCTTCACAGGAGGCTG -3'
Posted On2015-05-15