Incidental Mutation 'R4179:Myo1b'
ID319612
Institutional Source Beutler Lab
Gene Symbol Myo1b
Ensembl Gene ENSMUSG00000018417
Gene Namemyosin IB
Synonyms
MMRRC Submission 041015-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.421) question?
Stock #R4179 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location51749765-51916071 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 51778526 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 532 (F532L)
Ref Sequence ENSEMBL: ENSMUSP00000110188 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018561] [ENSMUST00000046390] [ENSMUST00000114537] [ENSMUST00000114541]
Predicted Effect probably damaging
Transcript: ENSMUST00000018561
AA Change: F526L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000018561
Gene: ENSMUSG00000018417
AA Change: F526L

DomainStartEndE-ValueType
MYSc 9 702 N/A SMART
IQ 703 725 2.37e-3 SMART
IQ 726 748 2.43e0 SMART
IQ 749 771 5.24e-5 SMART
IQ 778 800 4.59e0 SMART
IQ 807 829 7.07e-2 SMART
IQ 836 858 3.3e-2 SMART
Pfam:Myosin_TH1 941 1128 3e-41 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000046390
AA Change: F526L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000040447
Gene: ENSMUSG00000018417
AA Change: F526L

DomainStartEndE-ValueType
MYSc 9 702 N/A SMART
IQ 703 725 2.37e-3 SMART
IQ 726 748 2.43e0 SMART
IQ 749 771 5.24e-5 SMART
IQ 778 800 3.68e0 SMART
IQ 807 829 3.3e-2 SMART
Pfam:Myosin_TH1 911 1107 3.3e-51 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000114537
AA Change: F526L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110184
Gene: ENSMUSG00000018417
AA Change: F526L

DomainStartEndE-ValueType
MYSc 9 702 N/A SMART
IQ 703 725 2.37e-3 SMART
IQ 726 748 2.43e0 SMART
IQ 749 771 5.24e-5 SMART
IQ 778 800 1.6e0 SMART
Pfam:Myosin_TH1 882 1078 1.9e-51 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000114541
AA Change: F532L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110188
Gene: ENSMUSG00000018417
AA Change: F532L

DomainStartEndE-ValueType
MYSc 15 708 N/A SMART
IQ 709 731 2.37e-3 SMART
IQ 732 754 2.43e0 SMART
IQ 755 777 5.24e-5 SMART
IQ 784 806 1.6e0 SMART
Pfam:Myosin_TH1 888 1084 5.8e-52 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126952
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136273
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136701
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam34 T C 8: 43,651,091 M506V probably benign Het
Ano1 A T 7: 144,650,505 M290K probably damaging Het
Arrdc2 A T 8: 70,837,177 L34Q probably damaging Het
Cdadc1 G T 14: 59,592,486 T77N probably benign Het
Cmtr2 C G 8: 110,221,037 probably null Het
Cnot2 A T 10: 116,498,143 V374E possibly damaging Het
Crnn T C 3: 93,146,813 M1T probably null Het
Ctsb A G 14: 63,133,452 N38D probably benign Het
Dock10 A C 1: 80,510,417 S2010A probably benign Het
Dqx1 A G 6: 83,059,479 T155A probably benign Het
Dysf G A 6: 84,186,509 probably null Het
Eci1 T C 17: 24,436,277 W119R probably damaging Het
Foxo1 C A 3: 52,345,419 D334E probably benign Het
Gck T C 11: 5,910,295 T116A probably benign Het
Gcn1l1 T C 5: 115,588,050 V588A probably benign Het
Gm7168 A G 17: 13,949,003 I211V probably benign Het
Idh3g A T X: 73,782,004 probably null Het
Jag1 A G 2: 137,101,658 F206S probably damaging Het
Loxl3 G A 6: 83,037,584 V158I probably benign Het
Ly6g A G 15: 75,155,718 probably null Het
Naip1 T A 13: 100,426,176 N827I probably damaging Het
Nlrp9c G A 7: 26,384,661 H498Y possibly damaging Het
Olfr149 A G 9: 39,702,091 I226T probably benign Het
Pak2 C G 16: 32,052,187 G59A probably benign Het
Pcdha2 T A 18: 36,941,476 L720Q probably damaging Het
Pcdhb9 T A 18: 37,401,115 M54K probably benign Het
Pde2a A G 7: 101,481,383 *71W probably null Het
Pkd2l1 T C 19: 44,192,181 N32D probably benign Het
Pkhd1l1 A C 15: 44,523,649 Y1306S probably benign Het
Plec T C 15: 76,180,215 K1953R possibly damaging Het
Plekhg4 T A 8: 105,381,398 V1029E possibly damaging Het
Prkd1 C A 12: 50,366,448 G647C probably damaging Het
Ptch1 C T 13: 63,534,329 R537H probably damaging Het
Qser1 A G 2: 104,776,384 I1510T probably benign Het
Ranbp3l T C 15: 9,057,198 I314T possibly damaging Het
Rgs9 C A 11: 109,281,448 probably null Het
Riok1 T C 13: 38,048,955 F216L probably damaging Het
Rrm1 T A 7: 102,457,198 I308N probably damaging Het
Serpina1f A T 12: 103,691,920 M242K probably benign Het
Smox G A 2: 131,524,850 M576I possibly damaging Het
Spaca7 A T 8: 12,586,435 N87I probably damaging Het
Spink5 A T 18: 43,987,867 Q296L probably benign Het
Sspo T C 6: 48,498,395 probably null Het
Sult2b1 T A 7: 45,735,311 I114F probably damaging Het
Tex12 T C 9: 50,559,287 probably null Het
Tonsl A G 15: 76,624,475 L26P probably damaging Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Tsen54 T C 11: 115,820,852 V365A probably damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Usp47 T C 7: 112,087,884 L683P probably damaging Het
Wdr18 T C 10: 79,965,041 L146P probably damaging Het
Zfp709 A G 8: 71,889,906 Y392C probably damaging Het
Zranb3 A T 1: 127,960,864 I828N possibly damaging Het
Other mutations in Myo1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00540:Myo1b APN 1 51763954 missense possibly damaging 0.94
IGL00943:Myo1b APN 1 51784487 missense probably damaging 0.97
IGL01537:Myo1b APN 1 51776351 missense possibly damaging 0.93
IGL01550:Myo1b APN 1 51784531 missense probably damaging 1.00
IGL01610:Myo1b APN 1 51776246 missense probably damaging 1.00
IGL01667:Myo1b APN 1 51760377 missense probably damaging 1.00
IGL01743:Myo1b APN 1 51782020 missense probably damaging 0.96
IGL01830:Myo1b APN 1 51797465 nonsense probably null
IGL02070:Myo1b APN 1 51794337 missense probably damaging 1.00
IGL02398:Myo1b APN 1 51757891 missense probably damaging 1.00
IGL02582:Myo1b APN 1 51781974 missense possibly damaging 0.88
IGL02685:Myo1b APN 1 51778499 missense probably damaging 1.00
IGL02938:Myo1b APN 1 51801178 splice site probably null
IGL02981:Myo1b APN 1 51778373 missense probably damaging 1.00
R0007_myo1b_457 UTSW 1 51776254 missense probably damaging 1.00
R3034_myo1b_762 UTSW 1 51773247 missense possibly damaging 0.83
R7347_myo1b_243 UTSW 1 51751254 missense probably damaging 1.00
R0007:Myo1b UTSW 1 51776254 missense probably damaging 1.00
R0007:Myo1b UTSW 1 51776254 missense probably damaging 1.00
R0035:Myo1b UTSW 1 51778382 missense probably damaging 1.00
R0040:Myo1b UTSW 1 51781989 missense probably damaging 1.00
R0040:Myo1b UTSW 1 51781989 missense probably damaging 1.00
R0491:Myo1b UTSW 1 51755698 missense probably benign 0.05
R0959:Myo1b UTSW 1 51797087 missense probably damaging 1.00
R1171:Myo1b UTSW 1 51778525 missense probably damaging 1.00
R1440:Myo1b UTSW 1 51778558 splice site probably benign
R1539:Myo1b UTSW 1 51799563 missense probably damaging 0.97
R1616:Myo1b UTSW 1 51776315 missense probably damaging 1.00
R1888:Myo1b UTSW 1 51760403 critical splice acceptor site probably null
R1888:Myo1b UTSW 1 51760403 critical splice acceptor site probably null
R2697:Myo1b UTSW 1 51863358 missense probably benign 0.04
R3034:Myo1b UTSW 1 51773247 missense possibly damaging 0.83
R3720:Myo1b UTSW 1 51776346 missense possibly damaging 0.79
R3896:Myo1b UTSW 1 51773261 missense probably damaging 0.97
R4003:Myo1b UTSW 1 51799530 critical splice donor site probably null
R4308:Myo1b UTSW 1 51883109 missense probably benign 0.01
R4444:Myo1b UTSW 1 51757919 missense probably damaging 0.99
R4679:Myo1b UTSW 1 51757973 missense possibly damaging 0.94
R4914:Myo1b UTSW 1 51824208 splice site probably null
R5343:Myo1b UTSW 1 51778537 missense probably benign 0.00
R5530:Myo1b UTSW 1 51797423 missense probably damaging 1.00
R5636:Myo1b UTSW 1 51797528 missense probably damaging 1.00
R5956:Myo1b UTSW 1 51776232 missense probably damaging 1.00
R5974:Myo1b UTSW 1 51778373 missense probably damaging 1.00
R6334:Myo1b UTSW 1 51768651 missense probably null 0.36
R6346:Myo1b UTSW 1 51784507 missense probably damaging 1.00
R6382:Myo1b UTSW 1 51774307 splice site probably null
R6757:Myo1b UTSW 1 51813048 missense probably damaging 1.00
R6952:Myo1b UTSW 1 51762509 missense probably damaging 0.99
R7101:Myo1b UTSW 1 51758001 missense probably benign 0.19
R7192:Myo1b UTSW 1 51757217 missense probably damaging 0.99
R7347:Myo1b UTSW 1 51751254 missense probably damaging 1.00
R7446:Myo1b UTSW 1 51763906 missense possibly damaging 0.87
R7468:Myo1b UTSW 1 51797480 missense possibly damaging 0.78
R7503:Myo1b UTSW 1 51776602 splice site probably null
R7586:Myo1b UTSW 1 51778324 missense probably damaging 0.99
R7712:Myo1b UTSW 1 51793677 missense probably damaging 1.00
R7871:Myo1b UTSW 1 51779580 missense possibly damaging 0.89
R7905:Myo1b UTSW 1 51763884 splice site probably null
R8093:Myo1b UTSW 1 51757875 critical splice donor site probably null
R8485:Myo1b UTSW 1 51779601 missense probably damaging 1.00
R8705:Myo1b UTSW 1 51863336 nonsense probably null
R8731:Myo1b UTSW 1 51760411 splice site probably benign
R8735:Myo1b UTSW 1 51755737 missense probably benign 0.27
R8859:Myo1b UTSW 1 51797039 missense probably damaging 1.00
X0065:Myo1b UTSW 1 51797395 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCCCAGAAGCACCTGATGTAG -3'
(R):5'- ATCTTCAAGAGATGGAACTCAAAGC -3'

Sequencing Primer
(F):5'- AAGCACCTGATGTAGTTCGG -3'
(R):5'- CTGGAAGCAAACTTAGTATCAGTGTG -3'
Posted On2015-06-10