Mutagenetix > Incidental Mutation

Incidental Mutation 'R4179:Pkd2l1'

319667

Institutional Source

Beutler Lab

Gene Symbol

Pkd2l1

Ensembl Gene

ENSMUSG00000037578

Gene Name

polycystic kidney disease 2-like 1

Synonyms

PCL, PKD2L, Pkdl, polycystin-L, TRPP3

MMRRC Submission

041015-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.081) question?

Stock #

R4179 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

44147637-44192442 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 44192181 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Aspartic acid at position 32 (N32D)

Ref Sequence

ENSEMBL: ENSMUSP00000045675 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000042026]

AlphaFold

A2A259

Predicted Effect

probably benign
Transcript: ENSMUST00000042026
AA Change: N32D

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000045675
Gene: ENSMUSG00000037578
AA Change: N32D

Domain	Start	End	E-Value	Type
transmembrane domain	105	127	N/A	INTRINSIC
Pfam:PKD_channel	145	567	1.3e-172	PFAM
Pfam:Ion_trans	335	572	1.8e-30	PFAM
low complexity region	592	598	N/A	INTRINSIC
SCOP:d2pvba_	616	676	2e-4	SMART
PDB:4GIF\|A	698	739	1e-17	PDB

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000161357

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the polycystin protein family. The encoded protein contains multiple transmembrane domains, and cytoplasmic N- and C-termini. The protein may be an integral membrane protein involved in cell-cell/matrix interactions. This protein functions as a calcium-regulated nonselective cation channel. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased chorda tympani nerve response to sour tastants. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam34	T	C	8: 43,651,091	M506V	probably benign	Het
Ano1	A	T	7: 144,650,505	M290K	probably damaging	Het
Arrdc2	A	T	8: 70,837,177	L34Q	probably damaging	Het
Cdadc1	G	T	14: 59,592,486	T77N	probably benign	Het
Cmtr2	C	G	8: 110,221,037		probably null	Het
Cnot2	A	T	10: 116,498,143	V374E	possibly damaging	Het
Crnn	T	C	3: 93,146,813	M1T	probably null	Het
Ctsb	A	G	14: 63,133,452	N38D	probably benign	Het
Dock10	A	C	1: 80,510,417	S2010A	probably benign	Het
Dqx1	A	G	6: 83,059,479	T155A	probably benign	Het
Dysf	G	A	6: 84,186,509		probably null	Het
Eci1	T	C	17: 24,436,277	W119R	probably damaging	Het
Foxo1	C	A	3: 52,345,419	D334E	probably benign	Het
Gck	T	C	11: 5,910,295	T116A	probably benign	Het
Gcn1l1	T	C	5: 115,588,050	V588A	probably benign	Het
Gm7168	A	G	17: 13,949,003	I211V	probably benign	Het
Idh3g	A	T	X: 73,782,004		probably null	Het
Jag1	A	G	2: 137,101,658	F206S	probably damaging	Het
Loxl3	G	A	6: 83,037,584	V158I	probably benign	Het
Ly6g	A	G	15: 75,155,718		probably null	Het
Myo1b	A	G	1: 51,778,526	F532L	probably damaging	Het
Naip1	T	A	13: 100,426,176	N827I	probably damaging	Het
Nlrp9c	G	A	7: 26,384,661	H498Y	possibly damaging	Het
Olfr149	A	G	9: 39,702,091	I226T	probably benign	Het
Pak2	C	G	16: 32,052,187	G59A	probably benign	Het
Pcdha2	T	A	18: 36,941,476	L720Q	probably damaging	Het
Pcdhb9	T	A	18: 37,401,115	M54K	probably benign	Het
Pde2a	A	G	7: 101,481,383	*71W	probably null	Het
Pkhd1l1	A	C	15: 44,523,649	Y1306S	probably benign	Het
Plec	T	C	15: 76,180,215	K1953R	possibly damaging	Het
Plekhg4	T	A	8: 105,381,398	V1029E	possibly damaging	Het
Prkd1	C	A	12: 50,366,448	G647C	probably damaging	Het
Ptch1	C	T	13: 63,534,329	R537H	probably damaging	Het
Qser1	A	G	2: 104,776,384	I1510T	probably benign	Het
Ranbp3l	T	C	15: 9,057,198	I314T	possibly damaging	Het
Rgs9	C	A	11: 109,281,448		probably null	Het
Riok1	T	C	13: 38,048,955	F216L	probably damaging	Het
Rrm1	T	A	7: 102,457,198	I308N	probably damaging	Het
Serpina1f	A	T	12: 103,691,920	M242K	probably benign	Het
Smox	G	A	2: 131,524,850	M576I	possibly damaging	Het
Spaca7	A	T	8: 12,586,435	N87I	probably damaging	Het
Spink5	A	T	18: 43,987,867	Q296L	probably benign	Het
Sspo	T	C	6: 48,498,395		probably null	Het
Sult2b1	T	A	7: 45,735,311	I114F	probably damaging	Het
Tex12	T	C	9: 50,559,287		probably null	Het
Tonsl	A	G	15: 76,624,475	L26P	probably damaging	Het
Top2b	T	G	14: 16,409,189	I777M	probably damaging	Het
Tsen54	T	C	11: 115,820,852	V365A	probably damaging	Het
Ttn	A	T	2: 76,811,243	L5176Q	possibly damaging	Het
Usp47	T	C	7: 112,087,884	L683P	probably damaging	Het
Wdr18	T	C	10: 79,965,041	L146P	probably damaging	Het
Zfp709	A	G	8: 71,889,906	Y392C	probably damaging	Het
Zranb3	A	T	1: 127,960,864	I828N	possibly damaging	Het

Other mutations in Pkd2l1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00420:Pkd2l1	APN	19	44157636	critical splice donor site	probably null
IGL00426:Pkd2l1	APN	19	44155605	missense	probably benign	0.21
IGL00848:Pkd2l1	APN	19	44192279	utr 5 prime	probably benign
IGL01315:Pkd2l1	APN	19	44192196	missense	probably benign	0.09
IGL01654:Pkd2l1	APN	19	44154223	missense	probably damaging	0.98
IGL01786:Pkd2l1	APN	19	44191442	missense	probably damaging	0.96
IGL02174:Pkd2l1	APN	19	44157268	missense	probably benign	0.04
IGL02648:Pkd2l1	APN	19	44155536	missense	possibly damaging	0.72
R0654:Pkd2l1	UTSW	19	44157631	splice site	probably null
R0762:Pkd2l1	UTSW	19	44150470	missense	probably benign	0.19
R0981:Pkd2l1	UTSW	19	44154422	critical splice donor site	probably null
R1114:Pkd2l1	UTSW	19	44191544	splice site	probably benign
R1381:Pkd2l1	UTSW	19	44150463	missense	probably benign	0.08
R1467:Pkd2l1	UTSW	19	44154209	missense	possibly damaging	0.91
R1467:Pkd2l1	UTSW	19	44154209	missense	possibly damaging	0.91
R1754:Pkd2l1	UTSW	19	44155601	nonsense	probably null
R2009:Pkd2l1	UTSW	19	44155964	missense	probably benign	0.01
R2125:Pkd2l1	UTSW	19	44154500	missense	possibly damaging	0.91
R2696:Pkd2l1	UTSW	19	44157269	missense	probably benign	0.01
R3001:Pkd2l1	UTSW	19	44155557	missense	possibly damaging	0.81
R3002:Pkd2l1	UTSW	19	44155557	missense	possibly damaging	0.81
R3701:Pkd2l1	UTSW	19	44157227	missense	probably damaging	0.99
R4180:Pkd2l1	UTSW	19	44192181	missense	probably benign	0.01
R4614:Pkd2l1	UTSW	19	44154134	missense	probably damaging	0.99
R4616:Pkd2l1	UTSW	19	44154134	missense	probably damaging	0.99
R4617:Pkd2l1	UTSW	19	44154134	missense	probably damaging	0.99
R4618:Pkd2l1	UTSW	19	44154134	missense	probably damaging	0.99
R4762:Pkd2l1	UTSW	19	44155621	missense	probably benign	0.09
R4893:Pkd2l1	UTSW	19	44153771	missense	probably benign	0.00
R4907:Pkd2l1	UTSW	19	44154142	missense	possibly damaging	0.95
R5004:Pkd2l1	UTSW	19	44149577	missense	probably benign	0.00
R5380:Pkd2l1	UTSW	19	44157732	missense	probably benign	0.33
R5480:Pkd2l1	UTSW	19	44192156	missense	probably benign	0.18
R5950:Pkd2l1	UTSW	19	44152090	missense	probably benign	0.27
R6248:Pkd2l1	UTSW	19	44157669	missense	probably benign	0.00
R6908:Pkd2l1	UTSW	19	44152446	missense	probably damaging	1.00
R6925:Pkd2l1	UTSW	19	44191508	missense	possibly damaging	0.92
R7021:Pkd2l1	UTSW	19	44154208	missense	probably damaging	0.98
R7322:Pkd2l1	UTSW	19	44157690	missense	probably benign	0.00
R7378:Pkd2l1	UTSW	19	44153715	missense	probably benign	0.05
R7442:Pkd2l1	UTSW	19	44157229	missense	probably benign	0.01
R7636:Pkd2l1	UTSW	19	44191431	missense	possibly damaging	0.70
R7954:Pkd2l1	UTSW	19	44154212	missense	probably benign	0.15
R7989:Pkd2l1	UTSW	19	44154068	missense	probably benign	0.10
R9007:Pkd2l1	UTSW	19	44152425	missense	possibly damaging	0.49
R9245:Pkd2l1	UTSW	19	44155455	missense	probably benign	0.33
R9675:Pkd2l1	UTSW	19	44149257	missense	probably benign	0.00
X0026:Pkd2l1	UTSW	19	44157182	missense	probably damaging	1.00
Z1176:Pkd2l1	UTSW	19	44149271	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- TCCAGGAAAACCTCTCCTTGTG -3'
(R):5'- CCGAGGTTGAAAGGATCAGCTG -3'

Sequencing Primer
(F):5'- GTGCCCCGTACCTCTGATG -3'
(R):5'- TTAGACAATACTGCCTGGGC -3'

Posted On

2015-06-10