Incidental Mutation 'R4179:Pkd2l1'
ID319667
Institutional Source Beutler Lab
Gene Symbol Pkd2l1
Ensembl Gene ENSMUSG00000037578
Gene Namepolycystic kidney disease 2-like 1
SynonymsPCL, PKD2L, Pkdl, polycystin-L, TRPP3
MMRRC Submission 041015-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.090) question?
Stock #R4179 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location44147637-44192442 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 44192181 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 32 (N32D)
Ref Sequence ENSEMBL: ENSMUSP00000045675 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042026]
Predicted Effect probably benign
Transcript: ENSMUST00000042026
AA Change: N32D

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000045675
Gene: ENSMUSG00000037578
AA Change: N32D

DomainStartEndE-ValueType
transmembrane domain 105 127 N/A INTRINSIC
Pfam:PKD_channel 145 567 1.3e-172 PFAM
Pfam:Ion_trans 335 572 1.8e-30 PFAM
low complexity region 592 598 N/A INTRINSIC
SCOP:d2pvba_ 616 676 2e-4 SMART
PDB:4GIF|A 698 739 1e-17 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161357
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the polycystin protein family. The encoded protein contains multiple transmembrane domains, and cytoplasmic N- and C-termini. The protein may be an integral membrane protein involved in cell-cell/matrix interactions. This protein functions as a calcium-regulated nonselective cation channel. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased chorda tympani nerve response to sour tastants. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam34 T C 8: 43,651,091 M506V probably benign Het
Ano1 A T 7: 144,650,505 M290K probably damaging Het
Arrdc2 A T 8: 70,837,177 L34Q probably damaging Het
Cdadc1 G T 14: 59,592,486 T77N probably benign Het
Cmtr2 C G 8: 110,221,037 probably null Het
Cnot2 A T 10: 116,498,143 V374E possibly damaging Het
Crnn T C 3: 93,146,813 M1T probably null Het
Ctsb A G 14: 63,133,452 N38D probably benign Het
Dock10 A C 1: 80,510,417 S2010A probably benign Het
Dqx1 A G 6: 83,059,479 T155A probably benign Het
Dysf G A 6: 84,186,509 probably null Het
Eci1 T C 17: 24,436,277 W119R probably damaging Het
Foxo1 C A 3: 52,345,419 D334E probably benign Het
Gck T C 11: 5,910,295 T116A probably benign Het
Gcn1l1 T C 5: 115,588,050 V588A probably benign Het
Gm7168 A G 17: 13,949,003 I211V probably benign Het
Idh3g A T X: 73,782,004 probably null Het
Jag1 A G 2: 137,101,658 F206S probably damaging Het
Loxl3 G A 6: 83,037,584 V158I probably benign Het
Ly6g A G 15: 75,155,718 probably null Het
Myo1b A G 1: 51,778,526 F532L probably damaging Het
Naip1 T A 13: 100,426,176 N827I probably damaging Het
Nlrp9c G A 7: 26,384,661 H498Y possibly damaging Het
Olfr149 A G 9: 39,702,091 I226T probably benign Het
Pak2 C G 16: 32,052,187 G59A probably benign Het
Pcdha2 T A 18: 36,941,476 L720Q probably damaging Het
Pcdhb9 T A 18: 37,401,115 M54K probably benign Het
Pde2a A G 7: 101,481,383 *71W probably null Het
Pkhd1l1 A C 15: 44,523,649 Y1306S probably benign Het
Plec T C 15: 76,180,215 K1953R possibly damaging Het
Plekhg4 T A 8: 105,381,398 V1029E possibly damaging Het
Prkd1 C A 12: 50,366,448 G647C probably damaging Het
Ptch1 C T 13: 63,534,329 R537H probably damaging Het
Qser1 A G 2: 104,776,384 I1510T probably benign Het
Ranbp3l T C 15: 9,057,198 I314T possibly damaging Het
Rgs9 C A 11: 109,281,448 probably null Het
Riok1 T C 13: 38,048,955 F216L probably damaging Het
Rrm1 T A 7: 102,457,198 I308N probably damaging Het
Serpina1f A T 12: 103,691,920 M242K probably benign Het
Smox G A 2: 131,524,850 M576I possibly damaging Het
Spaca7 A T 8: 12,586,435 N87I probably damaging Het
Spink5 A T 18: 43,987,867 Q296L probably benign Het
Sspo T C 6: 48,498,395 probably null Het
Sult2b1 T A 7: 45,735,311 I114F probably damaging Het
Tex12 T C 9: 50,559,287 probably null Het
Tonsl A G 15: 76,624,475 L26P probably damaging Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Tsen54 T C 11: 115,820,852 V365A probably damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Usp47 T C 7: 112,087,884 L683P probably damaging Het
Wdr18 T C 10: 79,965,041 L146P probably damaging Het
Zfp709 A G 8: 71,889,906 Y392C probably damaging Het
Zranb3 A T 1: 127,960,864 I828N possibly damaging Het
Other mutations in Pkd2l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00420:Pkd2l1 APN 19 44157636 critical splice donor site probably null
IGL00426:Pkd2l1 APN 19 44155605 missense probably benign 0.21
IGL00848:Pkd2l1 APN 19 44192279 utr 5 prime probably benign
IGL01315:Pkd2l1 APN 19 44192196 missense probably benign 0.09
IGL01654:Pkd2l1 APN 19 44154223 missense probably damaging 0.98
IGL01786:Pkd2l1 APN 19 44191442 missense probably damaging 0.96
IGL02174:Pkd2l1 APN 19 44157268 missense probably benign 0.04
IGL02648:Pkd2l1 APN 19 44155536 missense possibly damaging 0.72
R0654:Pkd2l1 UTSW 19 44157631 splice site probably null
R0762:Pkd2l1 UTSW 19 44150470 missense probably benign 0.19
R0981:Pkd2l1 UTSW 19 44154422 critical splice donor site probably null
R1114:Pkd2l1 UTSW 19 44191544 splice site probably benign
R1381:Pkd2l1 UTSW 19 44150463 missense probably benign 0.08
R1467:Pkd2l1 UTSW 19 44154209 missense possibly damaging 0.91
R1467:Pkd2l1 UTSW 19 44154209 missense possibly damaging 0.91
R1754:Pkd2l1 UTSW 19 44155601 nonsense probably null
R2009:Pkd2l1 UTSW 19 44155964 missense probably benign 0.01
R2125:Pkd2l1 UTSW 19 44154500 missense possibly damaging 0.91
R2696:Pkd2l1 UTSW 19 44157269 missense probably benign 0.01
R3001:Pkd2l1 UTSW 19 44155557 missense possibly damaging 0.81
R3002:Pkd2l1 UTSW 19 44155557 missense possibly damaging 0.81
R3701:Pkd2l1 UTSW 19 44157227 missense probably damaging 0.99
R4180:Pkd2l1 UTSW 19 44192181 missense probably benign 0.01
R4614:Pkd2l1 UTSW 19 44154134 missense probably damaging 0.99
R4616:Pkd2l1 UTSW 19 44154134 missense probably damaging 0.99
R4617:Pkd2l1 UTSW 19 44154134 missense probably damaging 0.99
R4618:Pkd2l1 UTSW 19 44154134 missense probably damaging 0.99
R4762:Pkd2l1 UTSW 19 44155621 missense probably benign 0.09
R4893:Pkd2l1 UTSW 19 44153771 missense probably benign 0.00
R4907:Pkd2l1 UTSW 19 44154142 missense possibly damaging 0.95
R5004:Pkd2l1 UTSW 19 44149577 missense probably benign 0.00
R5380:Pkd2l1 UTSW 19 44157732 missense probably benign 0.33
R5480:Pkd2l1 UTSW 19 44192156 missense probably benign 0.18
R5950:Pkd2l1 UTSW 19 44152090 missense probably benign 0.27
R6248:Pkd2l1 UTSW 19 44157669 missense probably benign 0.00
R6908:Pkd2l1 UTSW 19 44152446 missense probably damaging 1.00
R6925:Pkd2l1 UTSW 19 44191508 missense possibly damaging 0.92
R7021:Pkd2l1 UTSW 19 44154208 missense probably damaging 0.98
R7322:Pkd2l1 UTSW 19 44157690 missense probably benign 0.00
R7378:Pkd2l1 UTSW 19 44153715 missense probably benign 0.05
R7442:Pkd2l1 UTSW 19 44157229 missense probably benign 0.01
R7636:Pkd2l1 UTSW 19 44191431 missense possibly damaging 0.70
R7954:Pkd2l1 UTSW 19 44154212 missense probably benign 0.15
R7989:Pkd2l1 UTSW 19 44154068 missense probably benign 0.10
X0026:Pkd2l1 UTSW 19 44157182 missense probably damaging 1.00
Z1176:Pkd2l1 UTSW 19 44149271 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCCAGGAAAACCTCTCCTTGTG -3'
(R):5'- CCGAGGTTGAAAGGATCAGCTG -3'

Sequencing Primer
(F):5'- GTGCCCCGTACCTCTGATG -3'
(R):5'- TTAGACAATACTGCCTGGGC -3'
Posted On2015-06-10