Incidental Mutation 'R4179:Wdr18'
ID319642
Institutional Source Beutler Lab
Gene Symbol Wdr18
Ensembl Gene ENSMUSG00000035754
Gene NameWD repeat domain 18
Synonyms2310012I10Rik
MMRRC Submission 041015-MU
Accession Numbers

Ncbi RefSeq: NM_175450.4; MGI: 2158400

Is this an essential gene? Probably essential (E-score: 0.961) question?
Stock #R4179 (G1)
Quality Score186
Status Not validated
Chromosome10
Chromosomal Location79960152-79970203 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 79965041 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 146 (L146P)
Ref Sequence ENSEMBL: ENSMUSP00000041049 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045247]
Predicted Effect probably damaging
Transcript: ENSMUST00000045247
AA Change: L146P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000041049
Gene: ENSMUSG00000035754
AA Change: L146P

DomainStartEndE-ValueType
Blast:WD40 27 66 3e-17 BLAST
WD40 70 107 1.48e1 SMART
WD40 110 149 1.24e-4 SMART
WD40 161 202 2.49e-1 SMART
WD40 205 243 2.05e1 SMART
WD40 258 297 2.32e-9 SMART
low complexity region 353 367 N/A INTRINSIC
Pfam:WD40_alt 383 429 4.3e-26 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218449
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218515
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220249
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220272
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the WD repeat protein family. WD repeats are minimally conserved regions of approximately 40 amino acids typically bracketed by gly-his and trp-asp (GH-WD), which may facilitate formation of heterotrimeric or multiprotein complexes. Members of this family are involved in a variety of cellular processes, including cell cycle progression, signal transduction, apoptosis, and gene regulation. [provided by RefSeq, Jul 2008]
Allele List at MGI

All alleles(8) : Targeted(1) Gene trapped(7)

Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam34 T C 8: 43,651,091 M506V probably benign Het
Ano1 A T 7: 144,650,505 M290K probably damaging Het
Arrdc2 A T 8: 70,837,177 L34Q probably damaging Het
Cdadc1 G T 14: 59,592,486 T77N probably benign Het
Cmtr2 C G 8: 110,221,037 probably null Het
Cnot2 A T 10: 116,498,143 V374E possibly damaging Het
Crnn T C 3: 93,146,813 M1T probably null Het
Ctsb A G 14: 63,133,452 N38D probably benign Het
Dock10 A C 1: 80,510,417 S2010A probably benign Het
Dqx1 A G 6: 83,059,479 T155A probably benign Het
Dysf G A 6: 84,186,509 probably null Het
Eci1 T C 17: 24,436,277 W119R probably damaging Het
Foxo1 C A 3: 52,345,419 D334E probably benign Het
Gck T C 11: 5,910,295 T116A probably benign Het
Gcn1l1 T C 5: 115,588,050 V588A probably benign Het
Gm7168 A G 17: 13,949,003 I211V probably benign Het
Idh3g A T X: 73,782,004 probably null Het
Jag1 A G 2: 137,101,658 F206S probably damaging Het
Loxl3 G A 6: 83,037,584 V158I probably benign Het
Ly6g A G 15: 75,155,718 probably null Het
Myo1b A G 1: 51,778,526 F532L probably damaging Het
Naip1 T A 13: 100,426,176 N827I probably damaging Het
Nlrp9c G A 7: 26,384,661 H498Y possibly damaging Het
Olfr149 A G 9: 39,702,091 I226T probably benign Het
Pak2 C G 16: 32,052,187 G59A probably benign Het
Pcdha2 T A 18: 36,941,476 L720Q probably damaging Het
Pcdhb9 T A 18: 37,401,115 M54K probably benign Het
Pde2a A G 7: 101,481,383 *71W probably null Het
Pkd2l1 T C 19: 44,192,181 N32D probably benign Het
Pkhd1l1 A C 15: 44,523,649 Y1306S probably benign Het
Plec T C 15: 76,180,215 K1953R possibly damaging Het
Plekhg4 T A 8: 105,381,398 V1029E possibly damaging Het
Prkd1 C A 12: 50,366,448 G647C probably damaging Het
Ptch1 C T 13: 63,534,329 R537H probably damaging Het
Qser1 A G 2: 104,776,384 I1510T probably benign Het
Ranbp3l T C 15: 9,057,198 I314T possibly damaging Het
Rgs9 C A 11: 109,281,448 probably null Het
Riok1 T C 13: 38,048,955 F216L probably damaging Het
Rrm1 T A 7: 102,457,198 I308N probably damaging Het
Serpina1f A T 12: 103,691,920 M242K probably benign Het
Smox G A 2: 131,524,850 M576I possibly damaging Het
Spaca7 A T 8: 12,586,435 N87I probably damaging Het
Spink5 A T 18: 43,987,867 Q296L probably benign Het
Sspo T C 6: 48,498,395 probably null Het
Sult2b1 T A 7: 45,735,311 I114F probably damaging Het
Tex12 T C 9: 50,559,287 probably null Het
Tonsl A G 15: 76,624,475 L26P probably damaging Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Tsen54 T C 11: 115,820,852 V365A probably damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Usp47 T C 7: 112,087,884 L683P probably damaging Het
Zfp709 A G 8: 71,889,906 Y392C probably damaging Het
Zranb3 A T 1: 127,960,864 I828N possibly damaging Het
Other mutations in Wdr18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01382:Wdr18 APN 10 79965272 missense probably damaging 1.00
IGL02812:Wdr18 APN 10 79961064 missense possibly damaging 0.68
IGL02949:Wdr18 APN 10 79965055 missense probably benign 0.00
R0066:Wdr18 UTSW 10 79961103 nonsense probably null
R0066:Wdr18 UTSW 10 79961103 nonsense probably null
R0244:Wdr18 UTSW 10 79966408 missense probably damaging 1.00
R0257:Wdr18 UTSW 10 79961119 splice site probably benign
R0377:Wdr18 UTSW 10 79967502 missense probably benign 0.40
R1844:Wdr18 UTSW 10 79966727 critical splice donor site probably null
R4674:Wdr18 UTSW 10 79965235 missense probably benign
R5573:Wdr18 UTSW 10 79965038 missense probably benign
R6007:Wdr18 UTSW 10 79965343 missense possibly damaging 0.94
R6455:Wdr18 UTSW 10 79965281 missense probably damaging 1.00
R7042:Wdr18 UTSW 10 79966110 missense probably benign 0.22
R7223:Wdr18 UTSW 10 79960368 missense probably damaging 1.00
R7316:Wdr18 UTSW 10 79965225 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCCTGGTTCCATATGCCAATG -3'
(R):5'- ACATGTCTTGGGGCAAGGATC -3'

Sequencing Primer
(F):5'- CAATGGCCCTGGAGCAG -3'
(R):5'- ATCCTGGATGGGTCTGCC -3'
Posted On2015-06-10