Incidental Mutation 'R4182:Pdcd6ip'
List |< first << previous [record 26 of 38] next >> last >|
ID319784
Institutional Source Beutler Lab
Gene Symbol Pdcd6ip
Ensembl Gene ENSMUSG00000032504
Gene Nameprogrammed cell death 6 interacting protein
SynonymsAlix, AIP1
MMRRC Submission 041018-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4182 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location113651744-113708259 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 113700010 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 75 (I75V)
Ref Sequence ENSEMBL: ENSMUSP00000107492 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035086] [ENSMUST00000111861]
Predicted Effect probably benign
Transcript: ENSMUST00000035086
AA Change: I75V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000035086
Gene: ENSMUSG00000032504
AA Change: I75V

DomainStartEndE-ValueType
BRO1 3 382 1.99e-160 SMART
Pfam:ALIX_LYPXL_bnd 408 702 3.6e-91 PFAM
low complexity region 731 812 N/A INTRINSIC
Blast:BRO1 813 839 2e-11 BLAST
low complexity region 840 869 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111861
AA Change: I75V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000107492
Gene: ENSMUSG00000032504
AA Change: I75V

DomainStartEndE-ValueType
BRO1 3 387 3.46e-160 SMART
Pfam:ALIX_LYPXL_bnd 417 706 8.8e-96 PFAM
low complexity region 736 817 N/A INTRINSIC
Blast:BRO1 818 844 2e-11 BLAST
low complexity region 845 874 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156425
Meta Mutation Damage Score 0.2270 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 98% (43/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that functions within the ESCRT pathway in the abscission stage of cytokinesis, in intralumenal endosomal vesicle formation, and in enveloped virus budding. Studies using mouse cells have shown that overexpression of this protein can block apoptosis. In addition, the product of this gene binds to the product of the PDCD6 gene, a protein required for apoptosis, in a calcium-dependent manner. This gene product also binds to endophilins, proteins that regulate membrane shape during endocytosis. Overexpression of this gene product and endophilins results in cytoplasmic vacuolization, which may be partly responsible for the protection against cell death. Several alternatively spliced transcript variants encoding different isoforms have been found for this gene. Related pseudogenes have been identified on chromosome 15. [provided by RefSeq, Jan 2012]
PHENOTYPE: Mice homozygous for a knock-out allele show decreased body and brain size and exhibit structural defects in the epithelium of the choroid plexus and in the brain ependyma that culminate in excessive cell extrusion, enlargement of the lateral ventricles, and hydrocephalus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap12 T C 18: 6,111,734 D210G probably damaging Het
Baz2b A T 2: 60,098,457 probably benign Het
Bcl9 A G 3: 97,213,683 probably null Het
Cfap20 A T 8: 95,424,656 I19N probably damaging Het
Clnk T A 5: 38,747,850 probably benign Het
Col18a1 C T 10: 77,058,841 probably null Het
Cux2 C T 5: 121,868,492 G905D probably damaging Het
Ddx1 A T 12: 13,231,503 L353* probably null Het
Ddx59 T A 1: 136,439,861 S569T probably benign Het
Des C G 1: 75,362,584 A251G probably benign Het
Dnajc21 T C 15: 10,459,933 probably null Het
Fam217a T C 13: 34,910,256 T416A possibly damaging Het
Gbp9 T A 5: 105,083,595 Q375L probably benign Het
Grsf1 G A 5: 88,664,156 P271S probably benign Het
H2-T24 A T 17: 36,015,484 N174K possibly damaging Het
Heatr3 T C 8: 88,171,002 probably benign Het
Lurap1l G A 4: 80,953,858 S196N probably benign Het
Naaa C T 5: 92,272,554 probably null Het
Nbea A G 3: 56,008,427 C875R probably damaging Het
Nme1 G A 11: 93,960,804 T87I probably benign Het
Nphp3 T C 9: 104,038,464 S124P probably benign Het
Nrap C T 19: 56,350,327 V907M probably damaging Het
Olfr1312 G T 2: 112,042,528 P168Q probably damaging Het
Olfr97 T G 17: 37,231,848 H174P possibly damaging Het
Pcdhga8 A G 18: 37,727,283 N464S probably damaging Het
Ralgapa2 G A 2: 146,435,994 P416S probably damaging Het
Saal1 A G 7: 46,710,652 probably benign Het
Susd5 A G 9: 114,095,985 E312G probably benign Het
Tgfb2 T A 1: 186,629,025 D315V possibly damaging Het
Tll1 C T 8: 64,041,511 D737N probably damaging Het
Tmem115 A G 9: 107,535,283 T269A probably damaging Het
Ttc39b T C 4: 83,237,301 D490G probably damaging Het
Vmn1r72 C T 7: 11,670,068 R151K probably benign Het
Vmn2r74 A T 7: 85,957,187 F317Y possibly damaging Het
Vmn2r79 A G 7: 87,001,891 H166R possibly damaging Het
Zfp560 A G 9: 20,347,448 I706T probably benign Het
Zfp982 A G 4: 147,512,693 K169R probably benign Het
Other mutations in Pdcd6ip
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Pdcd6ip APN 9 113697518 missense possibly damaging 0.89
IGL00814:Pdcd6ip APN 9 113687653 missense probably damaging 0.97
IGL01092:Pdcd6ip APN 9 113680181 splice site probably benign
IGL01621:Pdcd6ip APN 9 113685422 missense probably benign 0.03
IGL01781:Pdcd6ip APN 9 113691498 missense probably damaging 1.00
IGL02158:Pdcd6ip APN 9 113680053 nonsense probably null
IGL03136:Pdcd6ip APN 9 113691499 missense probably damaging 1.00
IGL03137:Pdcd6ip APN 9 113657145 missense possibly damaging 0.69
IGL03246:Pdcd6ip APN 9 113678417 missense possibly damaging 0.93
R0230:Pdcd6ip UTSW 9 113685293 splice site probably benign
R0284:Pdcd6ip UTSW 9 113662504 missense probably damaging 1.00
R0862:Pdcd6ip UTSW 9 113674510 splice site probably benign
R0864:Pdcd6ip UTSW 9 113674510 splice site probably benign
R1025:Pdcd6ip UTSW 9 113662286 missense probably damaging 1.00
R1687:Pdcd6ip UTSW 9 113700019 missense probably damaging 1.00
R1699:Pdcd6ip UTSW 9 113678354 missense probably damaging 1.00
R1957:Pdcd6ip UTSW 9 113708022 missense probably damaging 1.00
R2317:Pdcd6ip UTSW 9 113672774 missense probably benign 0.03
R2698:Pdcd6ip UTSW 9 113674507 splice site probably null
R5154:Pdcd6ip UTSW 9 113691542 missense probably damaging 1.00
R5229:Pdcd6ip UTSW 9 113678333 missense probably damaging 0.99
R5391:Pdcd6ip UTSW 9 113691518 missense probably damaging 1.00
R5972:Pdcd6ip UTSW 9 113662298 missense probably benign 0.07
R6149:Pdcd6ip UTSW 9 113659871 missense probably benign 0.03
R6406:Pdcd6ip UTSW 9 113674344 missense possibly damaging 0.81
R6514:Pdcd6ip UTSW 9 113689694 missense probably benign 0.43
R6869:Pdcd6ip UTSW 9 113655106 missense unknown
R6888:Pdcd6ip UTSW 9 113671837 missense probably benign 0.04
R7078:Pdcd6ip UTSW 9 113659885 missense probably benign 0.01
R7683:Pdcd6ip UTSW 9 113687695 missense probably damaging 1.00
R8260:Pdcd6ip UTSW 9 113672797 missense probably benign 0.05
R8376:Pdcd6ip UTSW 9 113689616 missense probably damaging 1.00
Z1177:Pdcd6ip UTSW 9 113685369 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- ATCCGACAGAGTCAAAACTTCTA -3'
(R):5'- GGTCACTGTAATTGGGGACA -3'

Sequencing Primer
(F):5'- AAGTGGGTGACTGCAAC -3'
(R):5'- TCAGATCTATGAACCTATGGGAGCC -3'
Posted On2015-06-10