Incidental Mutation 'R4303:Zfp579'
ID322492
Institutional Source Beutler Lab
Gene Symbol Zfp579
Ensembl Gene ENSMUSG00000051550
Gene Namezinc finger protein 579
Synonyms
MMRRC Submission 041090-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4303 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location4983483-4996158 bp(-) (GRCm38)
Type of Mutationutr 3 prime
DNA Base Change (assembly) A to G at 4993073 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000123963 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108572] [ENSMUST00000162502] [ENSMUST00000162731]
Predicted Effect probably benign
Transcript: ENSMUST00000108572
SMART Domains Protein: ENSMUSP00000104212
Gene: ENSMUSG00000051550

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
low complexity region 16 44 N/A INTRINSIC
ZnF_C2H2 46 68 8.09e-1 SMART
ZnF_C2H2 74 96 2.4e-3 SMART
ZnF_C2H2 102 125 3.83e-2 SMART
low complexity region 157 170 N/A INTRINSIC
low complexity region 189 216 N/A INTRINSIC
low complexity region 250 262 N/A INTRINSIC
ZnF_C2H2 267 289 1.36e-2 SMART
ZnF_C2H2 295 317 5.14e-3 SMART
low complexity region 318 368 N/A INTRINSIC
ZnF_C2H2 382 404 4.34e0 SMART
ZnF_C2H2 410 432 5.06e-2 SMART
ZnF_C2H2 439 461 1.92e-2 SMART
low complexity region 462 492 N/A INTRINSIC
low complexity region 511 525 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159754
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160225
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160808
Predicted Effect probably benign
Transcript: ENSMUST00000162502
SMART Domains Protein: ENSMUSP00000124074
Gene: ENSMUSG00000051550

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
low complexity region 16 44 N/A INTRINSIC
ZnF_C2H2 46 68 8.09e-1 SMART
ZnF_C2H2 74 96 2.4e-3 SMART
ZnF_C2H2 102 125 3.83e-2 SMART
low complexity region 157 170 N/A INTRINSIC
coiled coil region 190 213 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162731
SMART Domains Protein: ENSMUSP00000123963
Gene: ENSMUSG00000051550

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
low complexity region 16 44 N/A INTRINSIC
ZnF_C2H2 46 68 8.09e-1 SMART
ZnF_C2H2 74 96 2.4e-3 SMART
ZnF_C2H2 102 125 3.83e-2 SMART
low complexity region 157 170 N/A INTRINSIC
low complexity region 189 216 N/A INTRINSIC
low complexity region 250 262 N/A INTRINSIC
ZnF_C2H2 267 289 1.36e-2 SMART
ZnF_C2H2 295 317 5.14e-3 SMART
low complexity region 318 368 N/A INTRINSIC
ZnF_C2H2 382 404 4.34e0 SMART
ZnF_C2H2 410 432 5.06e-2 SMART
ZnF_C2H2 439 461 1.92e-2 SMART
low complexity region 462 492 N/A INTRINSIC
low complexity region 511 525 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency 98% (44/45)
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb8 T C 5: 24,401,057 S247P probably damaging Het
Atg4b A G 1: 93,768,262 E41G probably benign Het
Bckdk T C 7: 127,905,330 probably benign Het
Cacna2d1 A G 5: 16,302,248 probably null Het
Chaf1a A G 17: 56,044,068 D16G unknown Het
Defb12 A G 8: 19,112,721 I65T probably benign Het
Dnah7c T C 1: 46,748,578 Y3264H probably damaging Het
Ehhadh C A 16: 21,762,852 K463N probably damaging Het
Ehmt2 G A 17: 34,908,748 R901Q possibly damaging Het
Ern2 T C 7: 122,177,846 probably null Het
Esp6 A G 17: 40,565,144 T28A possibly damaging Het
Fam189a2 G A 19: 23,975,629 A439V probably damaging Het
Fam189a2 C T 19: 23,975,638 S436N probably damaging Het
Gm17333 A C 16: 77,852,879 noncoding transcript Het
Heatr5a T C 12: 51,956,225 T165A probably benign Het
Hoxa5 T C 6: 52,204,260 S31G probably benign Het
Ift80 A G 3: 68,894,174 I744T probably benign Het
Kalrn T C 16: 34,235,391 K853E probably damaging Het
Krt36 A T 11: 100,103,413 D279E possibly damaging Het
Map3k11 T A 19: 5,690,824 V193E probably damaging Het
Mrgpra4 T A 7: 47,980,936 M306L probably benign Het
Myo1a A G 10: 127,713,733 T428A probably benign Het
Nuggc A G 14: 65,611,172 H174R possibly damaging Het
Olfr293 G A 7: 86,663,955 V98M probably benign Het
Olfr389 A T 11: 73,776,838 M163K possibly damaging Het
Pigr G A 1: 130,841,817 D122N probably benign Het
Pik3ca C T 3: 32,439,935 R349* probably null Het
Rfxank T C 8: 70,136,212 D89G probably damaging Het
Rsf1 CGGCGGCGG CGGCGGCGGTGGCGGCGG 7: 97,579,920 probably benign Het
Serpina1a A G 12: 103,854,675 L348P probably damaging Het
Shank1 A G 7: 44,342,474 Y701C unknown Het
Six4 G T 12: 73,112,540 D207E possibly damaging Het
Slco3a1 G T 7: 74,554,528 D21E probably benign Het
Sox6 C T 7: 115,544,469 probably null Het
Spta1 A G 1: 174,179,852 N216S probably damaging Het
Stard13 T C 5: 151,062,869 N392S possibly damaging Het
Tax1bp1 T C 6: 52,727,278 V81A possibly damaging Het
Trim29 G T 9: 43,311,122 V83L probably damaging Het
Vmn1r90 C T 7: 14,561,570 W201* probably null Het
Wdr31 T A 4: 62,460,389 N7I probably damaging Het
Ypel4 A G 2: 84,736,807 probably benign Het
Zfp39 T C 11: 58,890,017 K640E probably damaging Het
Zfp974 C A 7: 27,910,232 K689N possibly damaging Het
Other mutations in Zfp579
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00971:Zfp579 APN 7 4993391 missense probably damaging 0.97
IGL01121:Zfp579 APN 7 4993247 missense possibly damaging 0.59
IGL01475:Zfp579 APN 7 4994744 missense probably benign 0.32
IGL01866:Zfp579 APN 7 4994258 missense possibly damaging 0.88
IGL02284:Zfp579 APN 7 4994168 missense probably damaging 0.99
IGL02313:Zfp579 APN 7 4994433 missense probably benign 0.23
R1803:Zfp579 UTSW 7 4993770 missense probably damaging 1.00
R2025:Zfp579 UTSW 7 4993521 nonsense probably null
R2026:Zfp579 UTSW 7 4993521 nonsense probably null
R2027:Zfp579 UTSW 7 4993521 nonsense probably null
R3690:Zfp579 UTSW 7 4994720 missense probably damaging 0.99
R6680:Zfp579 UTSW 7 4993502 missense probably damaging 0.99
R6826:Zfp579 UTSW 7 4994426 missense probably benign 0.01
R6869:Zfp579 UTSW 7 4994461 missense probably benign 0.00
R7304:Zfp579 UTSW 7 4994583 missense probably benign 0.22
X0028:Zfp579 UTSW 7 4993933 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TTTATTCACAGAGACAGAGGAACGG -3'
(R):5'- AGCCTTCGAGATGGAGGATG -3'

Sequencing Primer
(F):5'- AACGGGAGCAGACCTTTCG -3'
(R):5'- CACCTATGCGGATTGGGAG -3'
Posted On2015-06-20