Incidental Mutation 'R4400:Hyal2'
ID326594
Institutional Source Beutler Lab
Gene Symbol Hyal2
Ensembl Gene ENSMUSG00000010047
Gene Namehyaluronoglucosaminidase 2
Synonyms
MMRRC Submission 041131-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4400 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location107567945-107572779 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 107570853 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 235 (N235S)
Ref Sequence ENSEMBL: ENSMUSP00000141280 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000010191] [ENSMUST00000010198] [ENSMUST00000192887] [ENSMUST00000193747] [ENSMUST00000194794] [ENSMUST00000195681] [ENSMUST00000195752]
Predicted Effect probably damaging
Transcript: ENSMUST00000010191
AA Change: N235S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000010191
Gene: ENSMUSG00000010047
AA Change: N235S

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:Glyco_hydro_56 29 362 9.6e-140 PFAM
EGF 364 439 4.26e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000010198
SMART Domains Protein: ENSMUSP00000010198
Gene: ENSMUSG00000010054

DomainStartEndE-ValueType
Pfam:TUSC2 1 109 9.2e-47 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162027
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180865
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181099
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192051
Predicted Effect probably benign
Transcript: ENSMUST00000192887
SMART Domains Protein: ENSMUSP00000142207
Gene: ENSMUSG00000010047

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:Glyco_hydro_56 25 82 5.6e-14 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000193747
AA Change: N235S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142141
Gene: ENSMUSG00000010047
AA Change: N235S

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:Glyco_hydro_56 25 342 5.4e-133 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194628
Predicted Effect probably benign
Transcript: ENSMUST00000194794
SMART Domains Protein: ENSMUSP00000142019
Gene: ENSMUSG00000010047

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:Glyco_hydro_56 25 154 8.8e-50 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195667
Predicted Effect probably damaging
Transcript: ENSMUST00000195681
AA Change: N235S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000141820
Gene: ENSMUSG00000010047
AA Change: N235S

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:Glyco_hydro_56 25 325 3.8e-118 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000195752
AA Change: N235S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000141280
Gene: ENSMUSG00000010047
AA Change: N235S

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:Glyco_hydro_56 25 363 1.1e-144 PFAM
EGF 364 439 4.26e0 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a weak acid-active hyaluronidase. The encoded protein is similar in structure to other more active hyaluronidases. Hyaluronidases degrade hyaluronan, one of the major glycosaminoglycans of the extracellular matrix. Hyaluronan and fragments of hyaluronan are thought to be involved in cell proliferation, migration and differentiation. Although it was previously thought to be a lysosomal hyaluronidase that is active at a pH below 4, the encoded protein is likely a GPI-anchored cell surface protein. This hyaluronidase serves as a receptor for the oncogenic virus Jaagsiekte sheep retrovirus. The gene is one of several related genes in a region of chromosome 3p21.3 associated with tumor suppression. This gene encodes two alternatively spliced transcript variants which differ only in the 5' UTR.[provided by RefSeq, Mar 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit postnatal lethality, poor survival, craniofacial defects, and mild anemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atp4b A G 8: 13,388,810 F189L probably damaging Het
Atp8a1 A T 5: 67,764,878 Y372N probably benign Het
Bves T C 10: 45,369,293 V354A probably benign Het
Cd79b A T 11: 106,312,010 Y195* probably null Het
Cog6 A C 3: 53,012,941 D131E probably benign Het
Elp3 C T 14: 65,548,090 E421K possibly damaging Het
Fbxw28 A T 9: 109,328,310 F237Y probably damaging Het
Fezf1 T C 6: 23,247,710 N122S probably benign Het
Galnt2 A G 8: 124,324,303 K157E probably damaging Het
Git2 T C 5: 114,733,909 E141G possibly damaging Het
Gm26888 T C 11: 119,154,027 silent Het
Gnrhr T C 5: 86,182,249 probably null Het
Hoxd13 A T 2: 74,670,015 D300V probably damaging Het
Hspg2 G A 4: 137,548,122 A2748T probably benign Het
Itgam T G 7: 128,081,658 L253R probably damaging Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Matr3 A T 18: 35,583,916 K591N possibly damaging Het
Mep1a T A 17: 43,475,006 I731F possibly damaging Het
Mkl1 G A 15: 81,020,923 Q103* probably null Het
Muc5b A G 7: 141,861,387 D2690G possibly damaging Het
Nlrc5 A G 8: 94,494,353 Q1140R probably benign Het
Olfr205 C T 16: 59,328,598 V304I probably benign Het
Olfr292 A G 7: 86,694,590 I45V probably benign Het
Olfr711 A G 7: 106,972,002 L114P probably damaging Het
Plcl1 T C 1: 55,715,577 F1028L probably damaging Het
Plpp2 A G 10: 79,527,493 V106A possibly damaging Het
Prpf8 A G 11: 75,490,702 T255A possibly damaging Het
Shoc2 A G 19: 54,031,229 I568V probably benign Het
Spopl C T 2: 23,517,945 V241M probably damaging Het
Ssrp1 A T 2: 85,037,941 D9V probably damaging Het
Strn3 A T 12: 51,648,100 D293E possibly damaging Het
Tbx3 G T 5: 119,680,571 D404Y probably damaging Het
Tdrd7 T C 4: 46,005,540 S416P possibly damaging Het
Trim60 G T 8: 65,001,212 Y128* probably null Het
Tspoap1 T C 11: 87,775,603 S947P probably damaging Het
Ttn A T 2: 76,782,395 S17113R probably damaging Het
Ubqln1 T A 13: 58,193,388 N183I probably damaging Het
Ubr4 A G 4: 139,461,856 N3917D possibly damaging Het
Ucp2 A G 7: 100,499,350 *310W probably null Het
Wdr76 A G 2: 121,528,833 M218V probably damaging Het
Zranb3 A C 1: 127,956,655 L998R possibly damaging Het
Zxdc G A 6: 90,369,810 G51E probably damaging Het
Other mutations in Hyal2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00334:Hyal2 APN 9 107570405 missense probably damaging 1.00
IGL00337:Hyal2 APN 9 107572172 missense probably damaging 1.00
IGL01834:Hyal2 APN 9 107570906 missense probably damaging 1.00
IGL02469:Hyal2 APN 9 107572212 missense probably damaging 1.00
R0505:Hyal2 UTSW 9 107572071 missense probably benign 0.28
R1078:Hyal2 UTSW 9 107572246 missense probably benign
R1543:Hyal2 UTSW 9 107570187 missense probably damaging 0.98
R1858:Hyal2 UTSW 9 107572338 missense probably benign 0.01
R1974:Hyal2 UTSW 9 107572172 missense probably damaging 1.00
R3842:Hyal2 UTSW 9 107572121 missense probably damaging 0.99
R5111:Hyal2 UTSW 9 107571111 missense probably benign 0.00
R5922:Hyal2 UTSW 9 107570907 missense probably damaging 1.00
R6026:Hyal2 UTSW 9 107572199 missense probably benign 0.00
R6266:Hyal2 UTSW 9 107570715 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- TACGAGTTTGAGTTCGCCGC -3'
(R):5'- AACACGTACCTGGCTCAGTC -3'

Sequencing Primer
(F):5'- CCGCTCGGCAGTTCATGTTG -3'
(R):5'- TCAGTCCCGTGAGTCCTCG -3'
Posted On2015-07-07