Incidental Mutation 'R4400:Spopl'
ID326568
Institutional Source Beutler Lab
Gene Symbol Spopl
Ensembl Gene ENSMUSG00000026771
Gene Namespeckle-type POZ protein-like
SynonymsE430033K04Rik, 4921517N04Rik
MMRRC Submission 041131-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4400 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location23506220-23572106 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 23517945 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 241 (V241M)
Ref Sequence ENSEMBL: ENSMUSP00000114974 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028110] [ENSMUST00000132484] [ENSMUST00000132827]
Predicted Effect probably benign
Transcript: ENSMUST00000028110
SMART Domains Protein: ENSMUSP00000141519
Gene: ENSMUSG00000026771

DomainStartEndE-ValueType
MATH 2 108 5.9e-17 SMART
low complexity region 141 152 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000132484
AA Change: V241M

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000114974
Gene: ENSMUSG00000026771
AA Change: V241M

DomainStartEndE-ValueType
MATH 36 142 9.46e-15 SMART
BTB 200 297 5.99e-28 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000132827
SMART Domains Protein: ENSMUSP00000142047
Gene: ENSMUSG00000026771

DomainStartEndE-ValueType
MATH 36 142 5.9e-17 SMART
low complexity region 175 186 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136290
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195415
Meta Mutation Damage Score 0.266 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele are viable and fertile with no gross morphological and skeletal defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atp4b A G 8: 13,388,810 F189L probably damaging Het
Atp8a1 A T 5: 67,764,878 Y372N probably benign Het
Bves T C 10: 45,369,293 V354A probably benign Het
Cd79b A T 11: 106,312,010 Y195* probably null Het
Cog6 A C 3: 53,012,941 D131E probably benign Het
Elp3 C T 14: 65,548,090 E421K possibly damaging Het
Fbxw28 A T 9: 109,328,310 F237Y probably damaging Het
Fezf1 T C 6: 23,247,710 N122S probably benign Het
Galnt2 A G 8: 124,324,303 K157E probably damaging Het
Git2 T C 5: 114,733,909 E141G possibly damaging Het
Gm26888 T C 11: 119,154,027 silent Het
Gnrhr T C 5: 86,182,249 probably null Het
Hoxd13 A T 2: 74,670,015 D300V probably damaging Het
Hspg2 G A 4: 137,548,122 A2748T probably benign Het
Hyal2 A G 9: 107,570,853 N235S probably damaging Het
Itgam T G 7: 128,081,658 L253R probably damaging Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Matr3 A T 18: 35,583,916 K591N possibly damaging Het
Mep1a T A 17: 43,475,006 I731F possibly damaging Het
Mkl1 G A 15: 81,020,923 Q103* probably null Het
Muc5b A G 7: 141,861,387 D2690G possibly damaging Het
Nlrc5 A G 8: 94,494,353 Q1140R probably benign Het
Olfr205 C T 16: 59,328,598 V304I probably benign Het
Olfr292 A G 7: 86,694,590 I45V probably benign Het
Olfr711 A G 7: 106,972,002 L114P probably damaging Het
Plcl1 T C 1: 55,715,577 F1028L probably damaging Het
Plpp2 A G 10: 79,527,493 V106A possibly damaging Het
Prpf8 A G 11: 75,490,702 T255A possibly damaging Het
Shoc2 A G 19: 54,031,229 I568V probably benign Het
Ssrp1 A T 2: 85,037,941 D9V probably damaging Het
Strn3 A T 12: 51,648,100 D293E possibly damaging Het
Tbx3 G T 5: 119,680,571 D404Y probably damaging Het
Tdrd7 T C 4: 46,005,540 S416P possibly damaging Het
Trim60 G T 8: 65,001,212 Y128* probably null Het
Tspoap1 T C 11: 87,775,603 S947P probably damaging Het
Ttn A T 2: 76,782,395 S17113R probably damaging Het
Ubqln1 T A 13: 58,193,388 N183I probably damaging Het
Ubr4 A G 4: 139,461,856 N3917D possibly damaging Het
Ucp2 A G 7: 100,499,350 *310W probably null Het
Wdr76 A G 2: 121,528,833 M218V probably damaging Het
Zranb3 A C 1: 127,956,655 L998R possibly damaging Het
Zxdc G A 6: 90,369,810 G51E probably damaging Het
Other mutations in Spopl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Spopl APN 2 23537631 missense possibly damaging 0.88
P4748:Spopl UTSW 2 23511443 missense probably benign 0.01
PIT4453001:Spopl UTSW 2 23545449 missense probably damaging 0.99
R0738:Spopl UTSW 2 23537521 missense probably benign 0.04
R2358:Spopl UTSW 2 23537380 missense probably damaging 1.00
R3711:Spopl UTSW 2 23537380 missense probably damaging 1.00
R3712:Spopl UTSW 2 23537380 missense probably damaging 1.00
R4097:Spopl UTSW 2 23511401 missense probably benign 0.01
R4421:Spopl UTSW 2 23517945 missense probably damaging 0.97
R4497:Spopl UTSW 2 23517945 missense probably damaging 0.97
R4498:Spopl UTSW 2 23517945 missense probably damaging 0.97
R4570:Spopl UTSW 2 23537485 nonsense probably null
R4702:Spopl UTSW 2 23515297 splice site probably null
R6919:Spopl UTSW 2 23517861 missense probably benign 0.06
R7387:Spopl UTSW 2 23537509 missense probably benign
X0067:Spopl UTSW 2 23544867 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- GCTTCCAATAAATAGCAAGTTGGAGG -3'
(R):5'- AGGTTCTCACTTAGTAGCTTCACTATC -3'

Sequencing Primer
(F):5'- AGCAAGTTGGAGGATTTTTGTTTTTG -3'
(R):5'- AGTAGCTTCACTATCTCTGTATGTAC -3'
Posted On2015-07-07