Incidental Mutation 'R4400:Cd79b'
ID 326600
Institutional Source Beutler Lab
Gene Symbol Cd79b
Ensembl Gene ENSMUSG00000040592
Gene Name CD79B antigen
Synonyms Igbeta, Ig-beta, Igb, B29
MMRRC Submission 041131-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.085) question?
Stock # R4400 (G1)
Quality Score 225
Status Not validated
Chromosome 11
Chromosomal Location 106311341-106314762 bp(-) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) A to T at 106312010 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Stop codon at position 195 (Y195*)
Ref Sequence ENSEMBL: ENSMUSP00000129029 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044228] [ENSMUST00000167143]
AlphaFold P15530
PDB Structure Crystal structure of murine Ig-beta (CD79b) homodimer [X-RAY DIFFRACTION]
Crystal structure of murine Ig-beta (CD79b) in the monomeric form [X-RAY DIFFRACTION]
Predicted Effect probably null
Transcript: ENSMUST00000044228
AA Change: Y255*
SMART Domains Protein: ENSMUSP00000048239
Gene: ENSMUSG00000040592
AA Change: Y255*

low complexity region 29 40 N/A INTRINSIC
transmembrane domain 59 81 N/A INTRINSIC
IG 110 202 3.56e-9 SMART
transmembrane domain 220 239 N/A INTRINSIC
ITAM 252 272 2.41e-4 SMART
Predicted Effect probably null
Transcript: ENSMUST00000167143
AA Change: Y195*
SMART Domains Protein: ENSMUSP00000129029
Gene: ENSMUSG00000040592
AA Change: Y195*

low complexity region 14 21 N/A INTRINSIC
IG 50 142 3.56e-9 SMART
transmembrane domain 160 179 N/A INTRINSIC
ITAM 192 212 2.41e-4 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: The B lymphocyte antigen receptor is a multimeric complex that includes the antigen-specific component, surface immunoglobulin (Ig). Surface Ig non-covalently associates with two other proteins, Ig-alpha and Ig-beta, which are necessary for expression and function of the B-cell antigen receptor. This gene encodes the Ig-beta protein of the B-cell antigen component. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygotes for targeted null mutations exhibit arrested development of B cells at the pro-B cell stage due to diminished signaling of the B cell receptor. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atp4b A G 8: 13,388,810 F189L probably damaging Het
Atp8a1 A T 5: 67,764,878 Y372N probably benign Het
Bves T C 10: 45,369,293 V354A probably benign Het
Cog6 A C 3: 53,012,941 D131E probably benign Het
Elp3 C T 14: 65,548,090 E421K possibly damaging Het
Fbxw28 A T 9: 109,328,310 F237Y probably damaging Het
Fezf1 T C 6: 23,247,710 N122S probably benign Het
Galnt2 A G 8: 124,324,303 K157E probably damaging Het
Git2 T C 5: 114,733,909 E141G possibly damaging Het
Gm26888 T C 11: 119,154,027 silent Het
Gnrhr T C 5: 86,182,249 probably null Het
Hoxd13 A T 2: 74,670,015 D300V probably damaging Het
Hspg2 G A 4: 137,548,122 A2748T probably benign Het
Hyal2 A G 9: 107,570,853 N235S probably damaging Het
Itgam T G 7: 128,081,658 L253R probably damaging Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 74 probably benign Het
Matr3 A T 18: 35,583,916 K591N possibly damaging Het
Mep1a T A 17: 43,475,006 I731F possibly damaging Het
Mkl1 G A 15: 81,020,923 Q103* probably null Het
Muc5b A G 7: 141,861,387 D2690G possibly damaging Het
Nlrc5 A G 8: 94,494,353 Q1140R probably benign Het
Olfr205 C T 16: 59,328,598 V304I probably benign Het
Olfr292 A G 7: 86,694,590 I45V probably benign Het
Olfr711 A G 7: 106,972,002 L114P probably damaging Het
Plcl1 T C 1: 55,715,577 F1028L probably damaging Het
Plpp2 A G 10: 79,527,493 V106A possibly damaging Het
Prpf8 A G 11: 75,490,702 T255A possibly damaging Het
Shoc2 A G 19: 54,031,229 I568V probably benign Het
Spopl C T 2: 23,517,945 V241M probably damaging Het
Ssrp1 A T 2: 85,037,941 D9V probably damaging Het
Strn3 A T 12: 51,648,100 D293E possibly damaging Het
Tbx3 G T 5: 119,680,571 D404Y probably damaging Het
Tdrd7 T C 4: 46,005,540 S416P possibly damaging Het
Trim60 G T 8: 65,001,212 Y128* probably null Het
Tspoap1 T C 11: 87,775,603 S947P probably damaging Het
Ttn A T 2: 76,782,395 S17113R probably damaging Het
Ubqln1 T A 13: 58,193,388 N183I probably damaging Het
Ubr4 A G 4: 139,461,856 N3917D possibly damaging Het
Ucp2 A G 7: 100,499,350 *310W probably null Het
Wdr76 A G 2: 121,528,833 M218V probably damaging Het
Zranb3 A C 1: 127,956,655 L998R possibly damaging Het
Zxdc G A 6: 90,369,810 G51E probably damaging Het
Other mutations in Cd79b
AlleleSourceChrCoordTypePredicted EffectPPH Score
hallasan UTSW 11 106312441 critical splice acceptor site probably null
Jeju UTSW 11 106312713 missense probably damaging 1.00
R0070:Cd79b UTSW 11 106311918 splice site probably benign
R0070:Cd79b UTSW 11 106311918 splice site probably benign
R0731:Cd79b UTSW 11 106312433 missense probably damaging 1.00
R4591:Cd79b UTSW 11 106312046 missense probably damaging 1.00
R4948:Cd79b UTSW 11 106312861 missense probably benign 0.01
R6214:Cd79b UTSW 11 106312441 critical splice acceptor site probably null
R6215:Cd79b UTSW 11 106312441 critical splice acceptor site probably null
R6605:Cd79b UTSW 11 106312713 missense probably damaging 1.00
R7111:Cd79b UTSW 11 106314539 missense possibly damaging 0.73
R7114:Cd79b UTSW 11 106311887 missense probably damaging 1.00
R7401:Cd79b UTSW 11 106312852 missense probably benign 0.02
R8052:Cd79b UTSW 11 106313700 missense probably damaging 0.97
R8790:Cd79b UTSW 11 106312047 missense possibly damaging 0.93
R8921:Cd79b UTSW 11 106312806 missense probably benign 0.07
Predicted Primers PCR Primer

Sequencing Primer
Posted On 2015-07-07