Incidental Mutation 'R4415:Tacc3'
ID326787
Institutional Source Beutler Lab
Gene Symbol Tacc3
Ensembl Gene ENSMUSG00000037313
Gene Nametransforming, acidic coiled-coil containing protein 3
SynonymsAint, Arnt interacting protein
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4415 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location33658128-33678995 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to G at 33666684 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000110069 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074849] [ENSMUST00000079534] [ENSMUST00000114426] [ENSMUST00000152847] [ENSMUST00000201633]
Predicted Effect probably null
Transcript: ENSMUST00000074849
SMART Domains Protein: ENSMUSP00000074394
Gene: ENSMUSG00000037313

DomainStartEndE-ValueType
low complexity region 127 143 N/A INTRINSIC
internal_repeat_1 144 212 2.67e-29 PROSPERO
internal_repeat_1 240 308 2.67e-29 PROSPERO
Pfam:TACC 435 631 2.6e-74 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000079534
SMART Domains Protein: ENSMUSP00000078491
Gene: ENSMUSG00000037313

DomainStartEndE-ValueType
low complexity region 127 143 N/A INTRINSIC
internal_repeat_1 144 212 2.48e-29 PROSPERO
internal_repeat_1 240 308 2.48e-29 PROSPERO
Pfam:TACC 427 629 2.1e-73 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000114426
SMART Domains Protein: ENSMUSP00000110069
Gene: ENSMUSG00000037313

DomainStartEndE-ValueType
low complexity region 127 143 N/A INTRINSIC
internal_repeat_1 144 212 2.48e-29 PROSPERO
internal_repeat_1 240 308 2.48e-29 PROSPERO
Pfam:TACC 427 629 2.1e-73 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000138240
SMART Domains Protein: ENSMUSP00000115481
Gene: ENSMUSG00000037313

DomainStartEndE-ValueType
Pfam:TACC 1 136 5.8e-40 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139453
Predicted Effect probably benign
Transcript: ENSMUST00000139888
SMART Domains Protein: ENSMUSP00000117407
Gene: ENSMUSG00000037313

DomainStartEndE-ValueType
Pfam:TACC 1 155 1.2e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000152847
Predicted Effect probably benign
Transcript: ENSMUST00000201633
SMART Domains Protein: ENSMUSP00000144567
Gene: ENSMUSG00000037313

DomainStartEndE-ValueType
low complexity region 17 33 N/A INTRINSIC
internal_repeat_1 34 102 8.87e-21 PROSPERO
internal_repeat_1 130 198 8.87e-21 PROSPERO
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the transforming acidic colied-coil protein family. The encoded protein is a motor spindle protein that may play a role in stabilization of the mitotic spindle. This protein may also play a role in growth a differentiation of certain cancer cells. [provided by RefSeq, Nov 2011]
PHENOTYPE: Nullizygous mutations cause embryonic growth delay and prenatal death. Homozygotes for a null allele show hematopoietic deficiencies and severe facial clefts. Homozygotes for a hypomorphic allele die neonatally with malformed axial skeletons due to failed mitosis in mesenchymal sclerotome cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110017D15Rik T C 4: 41,505,574 T183A possibly damaging Het
Ace3 A T 11: 106,005,121 D631V probably benign Het
Adam17 T C 12: 21,345,701 I274V possibly damaging Het
Aebp1 A G 11: 5,865,451 D303G probably damaging Het
B020004C17Rik T C 14: 57,017,417 *233R probably null Het
Bcl9l C T 9: 44,501,879 P127S possibly damaging Het
Bdp1 T C 13: 100,030,861 D2215G probably damaging Het
Caly T C 7: 140,072,680 T52A probably damaging Het
Ccdc125 T C 13: 100,696,309 S465P possibly damaging Het
Cdc23 ACC AC 18: 34,637,318 probably null Het
Colq T C 14: 31,535,688 K231E probably damaging Het
Fam32a T A 8: 72,221,941 I77N probably damaging Het
Gm597 T A 1: 28,777,133 Q606L probably benign Het
Impdh1 C T 6: 29,209,222 V49M probably damaging Het
Kcnh7 A G 2: 62,706,073 I1055T probably damaging Het
Lad1 A G 1: 135,828,746 D364G probably benign Het
Lama2 G T 10: 26,989,344 Y947* probably null Het
Myo5b T A 18: 74,580,408 I108N probably damaging Het
Nvl T C 1: 181,105,114 T713A probably benign Het
Oit3 T C 10: 59,428,103 Y403C probably damaging Het
Olfr814 T C 10: 129,873,957 T267A probably benign Het
Pappa A G 4: 65,305,295 T1236A probably benign Het
Rcl1 G A 19: 29,118,362 V116I probably benign Het
Rdh14 G A 12: 10,391,231 probably null Het
Rfx2 T A 17: 56,787,733 T204S possibly damaging Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Ripor1 T C 8: 105,617,976 S581P probably benign Het
Rnf213 T A 11: 119,483,964 V5084E probably damaging Het
Scn9a A T 2: 66,526,693 V1077E probably damaging Het
Slc15a5 A G 6: 138,079,756 V54A probably benign Het
Slc35b2 G A 17: 45,566,429 V161M probably benign Het
Snx19 T A 9: 30,437,483 L804Q probably damaging Het
Specc1l C A 10: 75,246,328 N519K possibly damaging Het
Stambp A T 6: 83,557,482 N274K probably damaging Het
Stox1 T C 10: 62,659,569 N975S probably benign Het
Tmem55a C T 4: 14,912,463 R191C probably damaging Het
Tubb1 G A 2: 174,457,673 E383K probably benign Het
Ube3b A T 5: 114,412,444 D844V probably damaging Het
Other mutations in Tacc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00741:Tacc3 APN 5 33669640 missense probably damaging 1.00
IGL00742:Tacc3 APN 5 33661234 missense possibly damaging 0.86
IGL01390:Tacc3 APN 5 33668061 unclassified probably benign
R0714:Tacc3 UTSW 5 33671397 splice site probably benign
R1440:Tacc3 UTSW 5 33667977 missense probably benign 0.01
R1480:Tacc3 UTSW 5 33664597 missense probably benign 0.04
R1500:Tacc3 UTSW 5 33661308 missense probably damaging 0.99
R1851:Tacc3 UTSW 5 33668200 missense probably benign 0.03
R2136:Tacc3 UTSW 5 33671404 missense probably damaging 1.00
R2433:Tacc3 UTSW 5 33671739 missense possibly damaging 0.92
R4576:Tacc3 UTSW 5 33661497 intron probably benign
R4825:Tacc3 UTSW 5 33672013 missense probably damaging 1.00
R4960:Tacc3 UTSW 5 33671982 missense probably benign 0.30
R7121:Tacc3 UTSW 5 33667165 missense possibly damaging 0.71
R7464:Tacc3 UTSW 5 33661284 missense probably benign 0.12
R8071:Tacc3 UTSW 5 33663825 missense possibly damaging 0.92
R8425:Tacc3 UTSW 5 33664530 missense unknown
R8722:Tacc3 UTSW 5 33668209 missense probably damaging 1.00
RF020:Tacc3 UTSW 5 33661224 start codon destroyed probably null 0.53
Predicted Primers PCR Primer
(F):5'- TATAAAACTGGAAGCTCACCTAGG -3'
(R):5'- AGAGTCCTGGGTCAGAACTC -3'

Sequencing Primer
(F):5'- GGAAGCTCACCTAGGACTTTC -3'
(R):5'- GGTCAGAACTCTGCTGCAAGAC -3'
Posted On2015-07-07