Incidental Mutation 'R4415:Slc35b2'
ID326812
Institutional Source Beutler Lab
Gene Symbol Slc35b2
Ensembl Gene ENSMUSG00000037089
Gene Namesolute carrier family 35, member B2
SynonymsPAPST1, 1110003M08Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.187) question?
Stock #R4415 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location45563874-45567671 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 45566429 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 161 (V161M)
Ref Sequence ENSEMBL: ENSMUSP00000153367 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024739] [ENSMUST00000024742] [ENSMUST00000041353] [ENSMUST00000163966] [ENSMUST00000165127] [ENSMUST00000166469] [ENSMUST00000223987] [ENSMUST00000224905] [ENSMUST00000226086]
Predicted Effect probably benign
Transcript: ENSMUST00000024739
SMART Domains Protein: ENSMUSP00000024739
Gene: ENSMUSG00000023944

DomainStartEndE-ValueType
low complexity region 3 13 N/A INTRINSIC
HATPase_c 35 189 3.82e-10 SMART
Pfam:HSP90 191 719 5.4e-246 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000024742
SMART Domains Protein: ENSMUSP00000024742
Gene: ENSMUSG00000023947

DomainStartEndE-ValueType
low complexity region 36 48 N/A INTRINSIC
low complexity region 93 110 N/A INTRINSIC
ANK 122 152 1.14e2 SMART
ANK 157 187 2.15e0 SMART
ANK 190 219 6.81e-3 SMART
ANK 233 262 5.09e-2 SMART
ANK 267 296 1.12e-3 SMART
ANK 300 329 1e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000041353
AA Change: V112M

PolyPhen 2 Score 0.337 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000037834
Gene: ENSMUSG00000037089
AA Change: V112M

DomainStartEndE-ValueType
Pfam:UAA 62 363 5.1e-79 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145205
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146770
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151306
Predicted Effect probably benign
Transcript: ENSMUST00000163966
SMART Domains Protein: ENSMUSP00000131601
Gene: ENSMUSG00000023944

DomainStartEndE-ValueType
SCOP:d1byqa_ 9 85 9e-40 SMART
PDB:1UYM|A 14 85 3e-45 PDB
Blast:HATPase_c 35 85 9e-29 BLAST
low complexity region 93 107 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000165127
SMART Domains Protein: ENSMUSP00000126239
Gene: ENSMUSG00000023944

DomainStartEndE-ValueType
low complexity region 3 13 N/A INTRINSIC
Pfam:HSP90 37 161 3.8e-60 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000166469
SMART Domains Protein: ENSMUSP00000127338
Gene: ENSMUSG00000023944

DomainStartEndE-ValueType
Pfam:HSP90 4 189 1.3e-92 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000223987
AA Change: V112M

PolyPhen 2 Score 0.337 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect probably benign
Transcript: ENSMUST00000224341
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224559
Predicted Effect probably benign
Transcript: ENSMUST00000224905
AA Change: V161M

PolyPhen 2 Score 0.337 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect probably benign
Transcript: ENSMUST00000226086
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225226
Meta Mutation Damage Score 0.1078 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Sulfotransferases (e.g., SULT4A1; MIM 608359) use an activated form of sulfate, 3-prime-phosphoadenosine 5-prime-phosphosulfate (PAPS), as a common sulfate donor for sulfation of glycoproteins, proteoglycans, and glycolipids in the endoplasmic reticulum and Golgi apparatus. SLC35B2 is located in the microsomal membrane and transports PAPS from the cytosol, where it is synthesized, into the Golgi lumen (Kamiyama et al., 2003 [PubMed 12716889]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110017D15Rik T C 4: 41,505,574 T183A possibly damaging Het
Ace3 A T 11: 106,005,121 D631V probably benign Het
Adam17 T C 12: 21,345,701 I274V possibly damaging Het
Aebp1 A G 11: 5,865,451 D303G probably damaging Het
B020004C17Rik T C 14: 57,017,417 *233R probably null Het
Bcl9l C T 9: 44,501,879 P127S possibly damaging Het
Bdp1 T C 13: 100,030,861 D2215G probably damaging Het
Caly T C 7: 140,072,680 T52A probably damaging Het
Ccdc125 T C 13: 100,696,309 S465P possibly damaging Het
Cdc23 ACC AC 18: 34,637,318 probably null Het
Colq T C 14: 31,535,688 K231E probably damaging Het
Fam32a T A 8: 72,221,941 I77N probably damaging Het
Gm597 T A 1: 28,777,133 Q606L probably benign Het
Impdh1 C T 6: 29,209,222 V49M probably damaging Het
Kcnh7 A G 2: 62,706,073 I1055T probably damaging Het
Lad1 A G 1: 135,828,746 D364G probably benign Het
Lama2 G T 10: 26,989,344 Y947* probably null Het
Myo5b T A 18: 74,580,408 I108N probably damaging Het
Nvl T C 1: 181,105,114 T713A probably benign Het
Oit3 T C 10: 59,428,103 Y403C probably damaging Het
Olfr814 T C 10: 129,873,957 T267A probably benign Het
Pappa A G 4: 65,305,295 T1236A probably benign Het
Rcl1 G A 19: 29,118,362 V116I probably benign Het
Rdh14 G A 12: 10,391,231 probably null Het
Rfx2 T A 17: 56,787,733 T204S possibly damaging Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Ripor1 T C 8: 105,617,976 S581P probably benign Het
Rnf213 T A 11: 119,483,964 V5084E probably damaging Het
Scn9a A T 2: 66,526,693 V1077E probably damaging Het
Slc15a5 A G 6: 138,079,756 V54A probably benign Het
Snx19 T A 9: 30,437,483 L804Q probably damaging Het
Specc1l C A 10: 75,246,328 N519K possibly damaging Het
Stambp A T 6: 83,557,482 N274K probably damaging Het
Stox1 T C 10: 62,659,569 N975S probably benign Het
Tacc3 T G 5: 33,666,684 probably null Het
Tmem55a C T 4: 14,912,463 R191C probably damaging Het
Tubb1 G A 2: 174,457,673 E383K probably benign Het
Ube3b A T 5: 114,412,444 D844V probably damaging Het
Other mutations in Slc35b2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00579:Slc35b2 APN 17 45564960 missense probably damaging 0.99
IGL02749:Slc35b2 APN 17 45566567 missense probably benign 0.14
IGL02951:Slc35b2 APN 17 45564768 missense probably damaging 1.00
IGL03382:Slc35b2 APN 17 45566645 missense probably damaging 0.98
R0020:Slc35b2 UTSW 17 45566856 missense probably damaging 1.00
R0368:Slc35b2 UTSW 17 45566463 missense probably benign
R0743:Slc35b2 UTSW 17 45566825 missense probably damaging 1.00
R0884:Slc35b2 UTSW 17 45566825 missense probably damaging 1.00
R2293:Slc35b2 UTSW 17 45567141 missense probably damaging 1.00
R3894:Slc35b2 UTSW 17 45566442 missense probably benign 0.01
R4372:Slc35b2 UTSW 17 45566429 missense probably benign 0.34
R4416:Slc35b2 UTSW 17 45566429 missense probably benign 0.34
R4417:Slc35b2 UTSW 17 45566429 missense probably benign 0.34
R5291:Slc35b2 UTSW 17 45566498 missense probably damaging 1.00
R5314:Slc35b2 UTSW 17 45566498 missense probably damaging 1.00
R5929:Slc35b2 UTSW 17 45566661 missense probably benign 0.35
R6178:Slc35b2 UTSW 17 45566376 missense probably benign 0.10
R7217:Slc35b2 UTSW 17 45565029 missense probably benign 0.19
R7561:Slc35b2 UTSW 17 45566801 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGCTACCAACTCTGAGGAAGTAG -3'
(R):5'- CATCATCATGACAGGGATCACC -3'

Sequencing Primer
(F):5'- CTCTGAGGAAGTAGGAAACAGACTTC -3'
(R):5'- ATCACCTTGGAGGCCTTCG -3'
Posted On2015-07-07