Incidental Mutation 'R4416:Tmem63c'
ID326851
Institutional Source Beutler Lab
Gene Symbol Tmem63c
Ensembl Gene ENSMUSG00000034145
Gene Nametransmembrane protein 63c
Synonyms9330187M14Rik
MMRRC Submission 041137-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.090) question?
Stock #R4416 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location87021340-87090043 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 87081902 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Arginine at position 567 (T567R)
Ref Sequence ENSEMBL: ENSMUSP00000119872 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110187] [ENSMUST00000131878] [ENSMUST00000146292] [ENSMUST00000154801]
Predicted Effect probably benign
Transcript: ENSMUST00000110187
AA Change: T567R

PolyPhen 2 Score 0.144 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000105816
Gene: ENSMUSG00000034145
AA Change: T567R

DomainStartEndE-ValueType
Pfam:RSN1_TM 35 204 9.5e-21 PFAM
Pfam:DUF4463 253 323 6.1e-16 PFAM
Pfam:DUF221 341 680 8.9e-89 PFAM
transmembrane domain 682 704 N/A INTRINSIC
low complexity region 728 737 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000131878
AA Change: T567R

PolyPhen 2 Score 0.144 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000117023
Gene: ENSMUSG00000034145
AA Change: T567R

DomainStartEndE-ValueType
Pfam:RSN1_TM 35 204 9.5e-21 PFAM
Pfam:DUF4463 253 323 6.1e-16 PFAM
Pfam:DUF221 341 680 8.9e-89 PFAM
transmembrane domain 682 704 N/A INTRINSIC
low complexity region 728 737 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000146292
AA Change: T567R

PolyPhen 2 Score 0.144 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000119872
Gene: ENSMUSG00000034145
AA Change: T567R

DomainStartEndE-ValueType
Pfam:RSN1_TM 35 204 1.6e-20 PFAM
Pfam:PHM7_cyt 253 323 6e-12 PFAM
Pfam:RSN1_7TM 341 680 2.5e-88 PFAM
transmembrane domain 682 704 N/A INTRINSIC
low complexity region 728 737 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000154801
SMART Domains Protein: ENSMUSP00000119898
Gene: ENSMUSG00000034145

DomainStartEndE-ValueType
Pfam:RSN1_TM 35 179 1.6e-16 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220808
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110017D15Rik T C 4: 41,505,574 T183A possibly damaging Het
4933412E24Rik T A 15: 60,016,423 E56V possibly damaging Het
Adam28 A G 14: 68,622,082 probably null Het
Bnc1 G T 7: 81,968,960 H786N probably benign Het
Cav1 T A 6: 17,339,249 M100K probably benign Het
Cdk9 A G 2: 32,708,072 L273P probably damaging Het
Celsr1 A G 15: 85,927,999 V2065A probably damaging Het
Cyp2c54 T C 19: 40,038,259 Q484R probably benign Het
Elfn1 T C 5: 139,972,194 S318P possibly damaging Het
Fam160b1 G T 19: 57,385,397 probably null Het
Fbxl6 T C 15: 76,537,724 E205G possibly damaging Het
Frmd6 T A 12: 70,877,249 Y94N probably benign Het
Gdpd1 A T 11: 87,035,288 V277D probably benign Het
Gm1141 G A X: 71,939,619 C399Y possibly damaging Het
Grik1 C A 16: 88,051,461 V140L probably benign Het
Grpel1 A G 5: 36,471,272 H175R probably damaging Het
Gtdc1 G T 2: 44,575,590 probably null Het
Hivep2 A T 10: 14,129,170 Q504L probably benign Het
Icos A T 1: 60,994,690 I160L probably benign Het
Igsf9b G T 9: 27,322,917 C442F probably damaging Het
Itga10 T C 3: 96,658,246 V1062A possibly damaging Het
Lrp1b C T 2: 40,663,667 V386I unknown Het
Lrp2 G T 2: 69,527,231 F409L probably benign Het
Nadk T G 4: 155,587,726 Y291* probably null Het
Nudt6 A T 3: 37,405,229 probably null Het
Oit3 T C 10: 59,428,103 Y403C probably damaging Het
Olfr694 G A 7: 106,689,011 T240I probably benign Het
Olfr814 T C 10: 129,873,957 T267A probably benign Het
Olfr974 A G 9: 39,942,428 H56R probably damaging Het
Pds5b C T 5: 150,736,396 P275S probably damaging Het
Pdzd7 T A 19: 45,040,580 E117V probably damaging Het
Pik3ca T C 3: 32,461,530 V784A probably damaging Het
Polr3e T C 7: 120,939,057 probably null Het
Rab3gap2 A T 1: 185,282,347 D1231V probably benign Het
Rapgef2 C A 3: 79,069,057 G1481* probably null Het
Rho G A 6: 115,935,230 V76I probably benign Het
Rrm1 A G 7: 102,447,801 D96G probably benign Het
Slc35b2 G A 17: 45,566,429 V161M probably benign Het
Srp9 A T 1: 182,131,411 M50L probably benign Het
Stox1 T C 10: 62,659,569 N975S probably benign Het
Sult1d1 A G 5: 87,558,576 F169S probably damaging Het
Tmf1 G T 6: 97,178,988 F12L probably damaging Het
Ush2a T C 1: 188,356,874 I342T probably damaging Het
Veph1 A T 3: 66,061,185 N712K probably damaging Het
Vti1a T G 19: 55,380,948 S91A probably benign Het
Other mutations in Tmem63c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00730:Tmem63c APN 12 87077206 missense probably benign 0.05
IGL00837:Tmem63c APN 12 87077197 missense probably benign
IGL01317:Tmem63c APN 12 87071996 splice site probably benign
IGL01521:Tmem63c APN 12 87069144 missense probably damaging 0.99
IGL01955:Tmem63c APN 12 87077208 missense probably benign 0.00
IGL02007:Tmem63c APN 12 87072873 missense probably damaging 1.00
IGL02891:Tmem63c APN 12 87071268 missense probably benign 0.00
IGL03102:Tmem63c APN 12 87065549 missense probably benign 0.42
IGL03273:Tmem63c APN 12 87081802 missense probably damaging 1.00
R0238:Tmem63c UTSW 12 87075639 missense probably damaging 1.00
R0238:Tmem63c UTSW 12 87075639 missense probably damaging 1.00
R0239:Tmem63c UTSW 12 87075639 missense probably damaging 1.00
R0239:Tmem63c UTSW 12 87075639 missense probably damaging 1.00
R0975:Tmem63c UTSW 12 87075069 splice site probably benign
R2398:Tmem63c UTSW 12 87056533 missense probably damaging 1.00
R4721:Tmem63c UTSW 12 87057180 missense possibly damaging 0.70
R4881:Tmem63c UTSW 12 87086418 missense possibly damaging 0.67
R4888:Tmem63c UTSW 12 87089365 missense probably damaging 1.00
R5210:Tmem63c UTSW 12 87089398 missense probably benign 0.10
R5277:Tmem63c UTSW 12 87057757 splice site probably null
R5790:Tmem63c UTSW 12 87057636 missense probably benign 0.10
R5855:Tmem63c UTSW 12 87075726 missense probably damaging 1.00
R5940:Tmem63c UTSW 12 87075172 missense probably benign
R6000:Tmem63c UTSW 12 87057197 missense probably damaging 1.00
R6240:Tmem63c UTSW 12 87076405 missense possibly damaging 0.67
R6268:Tmem63c UTSW 12 87081953 missense probably damaging 1.00
R6749:Tmem63c UTSW 12 87075665 missense probably damaging 1.00
R7380:Tmem63c UTSW 12 87077948 missense probably benign 0.00
R7472:Tmem63c UTSW 12 87069158 missense possibly damaging 0.50
R8057:Tmem63c UTSW 12 87072198 nonsense probably null
R8184:Tmem63c UTSW 12 87061554 missense possibly damaging 0.93
Z1176:Tmem63c UTSW 12 87056485 missense probably benign 0.01
Z1177:Tmem63c UTSW 12 87077264 frame shift probably null
Predicted Primers PCR Primer
(F):5'- CCTGCGAAAACCCTTAGTGC -3'
(R):5'- TGGAGTCCAAGAAACAGCC -3'

Sequencing Primer
(F):5'- CCCTTAGTGCATAGAATGATTTTGGC -3'
(R):5'- CACCTATGGTCACAGGCCTC -3'
Posted On2015-07-07