Incidental Mutation 'R4408:Gm27013'
ID327759
Institutional Source Beutler Lab
Gene Symbol Gm27013
Ensembl Gene ENSMUSG00000098025
Gene Namepredicted gene, 27013
Synonyms
MMRRC Submission 041690-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.137) question?
Stock #R4408 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location130519764-130546306 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 130677765 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 245 (S245T)
Gene Model predicted gene model for transcript(s):
Predicted Effect possibly damaging
Transcript: ENSMUST00000182643
AA Change: S245T

PolyPhen 2 Score 0.904 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000138716
Gene: ENSMUSG00000098137
AA Change: S245T

DomainStartEndE-ValueType
KRAB 8 68 3.39e-35 SMART
ZnF_C2H2 453 503 1.83e2 SMART
ZnF_C2H2 509 531 6.99e-5 SMART
ZnF_C2H2 537 559 1.4e-4 SMART
ZnF_C2H2 565 587 1.6e-4 SMART
ZnF_C2H2 593 615 1.08e-5 SMART
ZnF_C2H2 621 643 1.2e-3 SMART
ZnF_C2H2 649 671 1.5e-4 SMART
ZnF_C2H2 677 699 1.58e-3 SMART
ZnF_C2H2 705 727 2.61e-4 SMART
ZnF_C2H2 733 755 4.79e-3 SMART
ZnF_C2H2 761 783 4.61e-5 SMART
ZnF_C2H2 789 811 1.13e-4 SMART
ZnF_C2H2 817 839 3.16e-3 SMART
ZnF_C2H2 845 867 1.28e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205067
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 97% (35/36)
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Cacna1h A G 17: 25,380,627 V1588A probably damaging Het
Card6 T A 15: 5,101,054 M287L probably damaging Het
Fam227b T A 2: 126,116,125 Y240F possibly damaging Het
Fbln1 T A 15: 85,231,556 probably null Het
Fndc5 A G 4: 129,142,529 probably null Het
Gm10799 C A 2: 104,068,064 A99S possibly damaging Het
Gm5592 A G 7: 41,286,448 T125A probably benign Het
Gml2 T C 15: 74,824,339 probably benign Het
Gpbp1 A T 13: 111,448,964 N149K possibly damaging Het
Gprc6a T C 10: 51,628,543 I68M probably benign Het
Hnrnpu T C 1: 178,330,803 probably benign Het
Irf5 A G 6: 29,534,001 probably null Het
Lrp2 T A 2: 69,467,169 K3149N probably benign Het
Lrrn3 A G 12: 41,454,042 V92A probably benign Het
Map3k12 T C 15: 102,505,402 T45A probably damaging Het
Myof A G 19: 37,922,978 S1502P probably damaging Het
Olfr1283 T A 2: 111,369,280 I216K possibly damaging Het
Olfr466 A G 13: 65,152,700 T159A probably benign Het
Osr2 T C 15: 35,300,471 Y58H possibly damaging Het
Pop5 C T 5: 115,240,777 probably benign Het
Ror2 A G 13: 53,118,961 C211R probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Sgsm2 C A 11: 74,851,766 R957L probably damaging Het
Slc16a11 A G 11: 70,215,734 probably null Het
Spag17 T A 3: 100,103,378 Y2063N probably benign Het
Usp25 A C 16: 77,115,453 K1020T probably damaging Het
Vmn1r23 T C 6: 57,926,368 I142V probably benign Het
Vmn1r235 A G 17: 21,261,592 K60E probably damaging Het
Vmn2r33 A C 7: 7,551,230 F775V probably damaging Het
Vps13b C T 15: 35,709,294 P1796S probably damaging Het
Vwa3a G A 7: 120,778,926 V480I probably benign Het
Other mutations in Gm27013
AlleleSourceChrCoordTypePredicted EffectPPH Score
R4175:Gm27013 UTSW 6 130677147 missense probably benign 0.00
R4229:Gm27013 UTSW 6 130677345 missense possibly damaging 0.89
R4585:Gm27013 UTSW 6 130521040 unclassified noncoding transcript
R4586:Gm27013 UTSW 6 130521040 unclassified noncoding transcript
R4823:Gm27013 UTSW 6 130522223 exon noncoding transcript
R4840:Gm27013 UTSW 6 130678116 missense probably benign 0.00
R4842:Gm27013 UTSW 6 130520737 unclassified noncoding transcript
R4943:Gm27013 UTSW 6 130676200 nonsense probably null
R4998:Gm27013 UTSW 6 130676538 missense probably damaging 0.98
R5087:Gm27013 UTSW 6 130677670 missense probably damaging 0.98
R5271:Gm27013 UTSW 6 130676915 missense probably damaging 1.00
R5507:Gm27013 UTSW 6 130675979 missense probably damaging 1.00
R5767:Gm27013 UTSW 6 130675958 missense possibly damaging 0.78
Predicted Primers PCR Primer
(F):5'- CTTATCTGATTTTCCCTTGGATGAG -3'
(R):5'- TCACAACTGGAGGATTTTCTAGG -3'

Sequencing Primer
(F):5'- TCCCTTGGATGAGTTTTACAAATAG -3'
(R):5'- TTGAAACACAAAACTATTTTACAGGG -3'
Posted On2015-07-07