Mutagenetix > Incidental Mutation

Incidental Mutation 'R4408:Gm5592'

327761

Institutional Source

Beutler Lab

Gene Symbol

Gm5592

Ensembl Gene

ENSMUSG00000072259

Gene Name

predicted gene 5592

Synonyms

MMRRC Submission

041690-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.067) question?

Stock #

R4408 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

41153841-41290183 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 41286448 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 125 (T125A)

Ref Sequence

ENSEMBL: ENSMUSP00000145899 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000097044] [ENSMUST00000206490]

AlphaFold

Q3V0A6

Predicted Effect

probably benign
Transcript: ENSMUST00000097044
AA Change: T125A

PolyPhen 2 Score 0.038 (Sensitivity: 0.94; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000094809
Gene: ENSMUSG00000072259
AA Change: T125A

Domain	Start	End	E-Value	Type
Pfam:DUF4629	435	580	6.1e-60	PFAM
low complexity region	607	612	N/A	INTRINSIC
low complexity region	708	725	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000206040

Predicted Effect

probably benign
Transcript: ENSMUST00000206490
AA Change: T125A

PolyPhen 2 Score 0.038 (Sensitivity: 0.94; Specificity: 0.82)

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.6%

Validation Efficiency

97% (35/36)

Allele List at MGI

Other mutations in this stock

Total: 31 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Cacna1h	A	G	17: 25,380,627	V1588A	probably damaging	Het
Card6	T	A	15: 5,101,054	M287L	probably damaging	Het
Fam227b	T	A	2: 126,116,125	Y240F	possibly damaging	Het
Fbln1	T	A	15: 85,231,556		probably null	Het
Fndc5	A	G	4: 129,142,529		probably null	Het
Gm10799	C	A	2: 104,068,064	A99S	possibly damaging	Het
Gm27013	A	T	6: 130,677,765	S245T	possibly damaging	Het
Gml2	T	C	15: 74,824,339		probably benign	Het
Gpbp1	A	T	13: 111,448,964	N149K	possibly damaging	Het
Gprc6a	T	C	10: 51,628,543	I68M	probably benign	Het
Hnrnpu	T	C	1: 178,330,803		probably benign	Het
Irf5	A	G	6: 29,534,001		probably null	Het
Lrp2	T	A	2: 69,467,169	K3149N	probably benign	Het
Lrrn3	A	G	12: 41,454,042	V92A	probably benign	Het
Map3k12	T	C	15: 102,505,402	T45A	probably damaging	Het
Myof	A	G	19: 37,922,978	S1502P	probably damaging	Het
Olfr1283	T	A	2: 111,369,280	I216K	possibly damaging	Het
Olfr466	A	G	13: 65,152,700	T159A	probably benign	Het
Osr2	T	C	15: 35,300,471	Y58H	possibly damaging	Het
Pop5	C	T	5: 115,240,777		probably benign	Het
Ror2	A	G	13: 53,118,961	C211R	probably damaging	Het
Rufy4	T	C	1: 74,147,663	C537R	probably damaging	Het
Sgsm2	C	A	11: 74,851,766	R957L	probably damaging	Het
Slc16a11	A	G	11: 70,215,734		probably null	Het
Spag17	T	A	3: 100,103,378	Y2063N	probably benign	Het
Usp25	A	C	16: 77,115,453	K1020T	probably damaging	Het
Vmn1r23	T	C	6: 57,926,368	I142V	probably benign	Het
Vmn1r235	A	G	17: 21,261,592	K60E	probably damaging	Het
Vmn2r33	A	C	7: 7,551,230	F775V	probably damaging	Het
Vps13b	C	T	15: 35,709,294	P1796S	probably damaging	Het
Vwa3a	G	A	7: 120,778,926	V480I	probably benign	Het

Other mutations in Gm5592

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00966:Gm5592	APN	7	41289095	missense	probably damaging	1.00
IGL01472:Gm5592	APN	7	41286074	splice site	probably benign
IGL01718:Gm5592	APN	7	41289193	missense	probably damaging	0.99
IGL01981:Gm5592	APN	7	41286371	nonsense	probably null
IGL02318:Gm5592	APN	7	41286788	missense	probably benign	0.37
IGL02346:Gm5592	APN	7	41289465	missense	probably damaging	0.97
IGL02904:Gm5592	APN	7	41288386	missense	probably damaging	1.00
I1329:Gm5592	UTSW	7	41286354	nonsense	probably null
R0465:Gm5592	UTSW	7	41156057	intron	probably benign
R0669:Gm5592	UTSW	7	41155830	intron	probably benign
R0675:Gm5592	UTSW	7	41289387	missense	possibly damaging	0.81
R1381:Gm5592	UTSW	7	41286172	missense	probably benign
R1731:Gm5592	UTSW	7	41288413	missense	probably damaging	0.99
R3149:Gm5592	UTSW	7	41288380	missense	probably benign	0.00
R3150:Gm5592	UTSW	7	41288380	missense	probably benign	0.00
R3176:Gm5592	UTSW	7	41288380	missense	probably benign	0.00
R3177:Gm5592	UTSW	7	41288380	missense	probably benign	0.00
R3276:Gm5592	UTSW	7	41288380	missense	probably benign	0.00
R3277:Gm5592	UTSW	7	41288380	missense	probably benign	0.00
R3623:Gm5592	UTSW	7	41157628	intron	probably benign
R3797:Gm5592	UTSW	7	41157835	intron	probably benign
R3854:Gm5592	UTSW	7	41157835	intron	probably benign
R3856:Gm5592	UTSW	7	41157835	intron	probably benign
R4009:Gm5592	UTSW	7	41289510	missense	probably benign	0.01
R4010:Gm5592	UTSW	7	41286628	missense	probably benign	0.05
R4011:Gm5592	UTSW	7	41289510	missense	probably benign	0.01
R4127:Gm5592	UTSW	7	41289067	missense	probably benign	0.00
R4162:Gm5592	UTSW	7	41217778	intron	probably benign
R4289:Gm5592	UTSW	7	41158912	intron	probably benign
R4304:Gm5592	UTSW	7	41286262	missense	probably benign	0.20
R4332:Gm5592	UTSW	7	41216118	intron	probably benign
R4572:Gm5592	UTSW	7	41216159	intron	probably benign
R4764:Gm5592	UTSW	7	41216118	intron	probably benign
R4822:Gm5592	UTSW	7	41155890	intron	probably benign
R4836:Gm5592	UTSW	7	41215534	intron	probably benign
R4854:Gm5592	UTSW	7	41217471	intron	probably benign
R5032:Gm5592	UTSW	7	41289735	missense	probably damaging	1.00
R5075:Gm5592	UTSW	7	41158963	intron	probably benign
R5369:Gm5592	UTSW	7	41218211	intron	probably benign
R5424:Gm5592	UTSW	7	41155593	intron	probably benign
R5700:Gm5592	UTSW	7	41158579	intron	probably benign
R5741:Gm5592	UTSW	7	41289201	missense	probably benign
R5802:Gm5592	UTSW	7	41219105	intron	probably benign
R5945:Gm5592	UTSW	7	41215612	intron	probably benign
R6117:Gm5592	UTSW	7	41288464	missense	probably benign	0.00
R6324:Gm5592	UTSW	7	41286535	missense	probably damaging	0.98
R6449:Gm5592	UTSW	7	41288586	missense	probably benign	0.09
R6571:Gm5592	UTSW	7	41288575	missense	probably damaging	0.98
R6776:Gm5592	UTSW	7	41289729	missense	probably damaging	1.00
R7595:Gm5592	UTSW	7	41286443	missense	probably damaging	0.99
R7658:Gm5592	UTSW	7	41288710	missense	probably benign	0.03
R7699:Gm5592	UTSW	7	41286407	missense	probably damaging	1.00
R7700:Gm5592	UTSW	7	41286407	missense	probably damaging	1.00
R7774:Gm5592	UTSW	7	41289859	missense	probably damaging	1.00
R7788:Gm5592	UTSW	7	41286694	missense	probably benign	0.01
R7890:Gm5592	UTSW	7	41286759	missense	probably damaging	1.00
R8070:Gm5592	UTSW	7	41286463	missense	possibly damaging	0.76
R8417:Gm5592	UTSW	7	41288551	missense	probably benign	0.38
R8866:Gm5592	UTSW	7	41288822	missense	possibly damaging	0.74
R9044:Gm5592	UTSW	7	41288850	missense	probably benign	0.25
R9057:Gm5592	UTSW	7	41289463	missense	possibly damaging	0.93
R9258:Gm5592	UTSW	7	41288983	missense	possibly damaging	0.56
R9451:Gm5592	UTSW	7	41286452	missense	probably damaging	0.99
R9760:Gm5592	UTSW	7	41289810	missense	possibly damaging	0.57
X0021:Gm5592	UTSW	7	41288508	missense	probably benign	0.01
Z1176:Gm5592	UTSW	7	41286317	missense	probably damaging	1.00
Z1176:Gm5592	UTSW	7	41286319	missense	possibly damaging	0.94
Z1176:Gm5592	UTSW	7	41288681	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- GGCTTCTACCATCAGCATCCAG -3'
(R):5'- GTAATAGACCTGGCTGCCTTC -3'

Sequencing Primer
(F):5'- GGGTAATGCCTATCTTAACCCACATG -3'
(R):5'- TCCTGGTAGGAAGGTGCCAG -3'

Posted On

2015-07-07