Incidental Mutation 'R4408:Gm5592'
ID 327761
Institutional Source Beutler Lab
Gene Symbol Gm5592
Ensembl Gene ENSMUSG00000072259
Gene Name predicted gene 5592
Synonyms
MMRRC Submission 041690-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.067) question?
Stock # R4408 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 41153841-41290183 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 41286448 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 125 (T125A)
Ref Sequence ENSEMBL: ENSMUSP00000145899 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097044] [ENSMUST00000206490]
AlphaFold Q3V0A6
Predicted Effect probably benign
Transcript: ENSMUST00000097044
AA Change: T125A

PolyPhen 2 Score 0.038 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000094809
Gene: ENSMUSG00000072259
AA Change: T125A

DomainStartEndE-ValueType
Pfam:DUF4629 435 580 6.1e-60 PFAM
low complexity region 607 612 N/A INTRINSIC
low complexity region 708 725 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206040
Predicted Effect probably benign
Transcript: ENSMUST00000206490
AA Change: T125A

PolyPhen 2 Score 0.038 (Sensitivity: 0.94; Specificity: 0.82)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 97% (35/36)
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Cacna1h A G 17: 25,380,627 V1588A probably damaging Het
Card6 T A 15: 5,101,054 M287L probably damaging Het
Fam227b T A 2: 126,116,125 Y240F possibly damaging Het
Fbln1 T A 15: 85,231,556 probably null Het
Fndc5 A G 4: 129,142,529 probably null Het
Gm10799 C A 2: 104,068,064 A99S possibly damaging Het
Gm27013 A T 6: 130,677,765 S245T possibly damaging Het
Gml2 T C 15: 74,824,339 probably benign Het
Gpbp1 A T 13: 111,448,964 N149K possibly damaging Het
Gprc6a T C 10: 51,628,543 I68M probably benign Het
Hnrnpu T C 1: 178,330,803 probably benign Het
Irf5 A G 6: 29,534,001 probably null Het
Lrp2 T A 2: 69,467,169 K3149N probably benign Het
Lrrn3 A G 12: 41,454,042 V92A probably benign Het
Map3k12 T C 15: 102,505,402 T45A probably damaging Het
Myof A G 19: 37,922,978 S1502P probably damaging Het
Olfr1283 T A 2: 111,369,280 I216K possibly damaging Het
Olfr466 A G 13: 65,152,700 T159A probably benign Het
Osr2 T C 15: 35,300,471 Y58H possibly damaging Het
Pop5 C T 5: 115,240,777 probably benign Het
Ror2 A G 13: 53,118,961 C211R probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Sgsm2 C A 11: 74,851,766 R957L probably damaging Het
Slc16a11 A G 11: 70,215,734 probably null Het
Spag17 T A 3: 100,103,378 Y2063N probably benign Het
Usp25 A C 16: 77,115,453 K1020T probably damaging Het
Vmn1r23 T C 6: 57,926,368 I142V probably benign Het
Vmn1r235 A G 17: 21,261,592 K60E probably damaging Het
Vmn2r33 A C 7: 7,551,230 F775V probably damaging Het
Vps13b C T 15: 35,709,294 P1796S probably damaging Het
Vwa3a G A 7: 120,778,926 V480I probably benign Het
Other mutations in Gm5592
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00966:Gm5592 APN 7 41289095 missense probably damaging 1.00
IGL01472:Gm5592 APN 7 41286074 splice site probably benign
IGL01718:Gm5592 APN 7 41289193 missense probably damaging 0.99
IGL01981:Gm5592 APN 7 41286371 nonsense probably null
IGL02318:Gm5592 APN 7 41286788 missense probably benign 0.37
IGL02346:Gm5592 APN 7 41289465 missense probably damaging 0.97
IGL02904:Gm5592 APN 7 41288386 missense probably damaging 1.00
I1329:Gm5592 UTSW 7 41286354 nonsense probably null
R0465:Gm5592 UTSW 7 41156057 intron probably benign
R0669:Gm5592 UTSW 7 41155830 intron probably benign
R0675:Gm5592 UTSW 7 41289387 missense possibly damaging 0.81
R1381:Gm5592 UTSW 7 41286172 missense probably benign
R1731:Gm5592 UTSW 7 41288413 missense probably damaging 0.99
R3149:Gm5592 UTSW 7 41288380 missense probably benign 0.00
R3150:Gm5592 UTSW 7 41288380 missense probably benign 0.00
R3176:Gm5592 UTSW 7 41288380 missense probably benign 0.00
R3177:Gm5592 UTSW 7 41288380 missense probably benign 0.00
R3276:Gm5592 UTSW 7 41288380 missense probably benign 0.00
R3277:Gm5592 UTSW 7 41288380 missense probably benign 0.00
R3623:Gm5592 UTSW 7 41157628 intron probably benign
R3797:Gm5592 UTSW 7 41157835 intron probably benign
R3854:Gm5592 UTSW 7 41157835 intron probably benign
R3856:Gm5592 UTSW 7 41157835 intron probably benign
R4009:Gm5592 UTSW 7 41289510 missense probably benign 0.01
R4010:Gm5592 UTSW 7 41286628 missense probably benign 0.05
R4011:Gm5592 UTSW 7 41289510 missense probably benign 0.01
R4127:Gm5592 UTSW 7 41289067 missense probably benign 0.00
R4162:Gm5592 UTSW 7 41217778 intron probably benign
R4289:Gm5592 UTSW 7 41158912 intron probably benign
R4304:Gm5592 UTSW 7 41286262 missense probably benign 0.20
R4332:Gm5592 UTSW 7 41216118 intron probably benign
R4572:Gm5592 UTSW 7 41216159 intron probably benign
R4764:Gm5592 UTSW 7 41216118 intron probably benign
R4822:Gm5592 UTSW 7 41155890 intron probably benign
R4836:Gm5592 UTSW 7 41215534 intron probably benign
R4854:Gm5592 UTSW 7 41217471 intron probably benign
R5032:Gm5592 UTSW 7 41289735 missense probably damaging 1.00
R5075:Gm5592 UTSW 7 41158963 intron probably benign
R5369:Gm5592 UTSW 7 41218211 intron probably benign
R5424:Gm5592 UTSW 7 41155593 intron probably benign
R5700:Gm5592 UTSW 7 41158579 intron probably benign
R5741:Gm5592 UTSW 7 41289201 missense probably benign
R5802:Gm5592 UTSW 7 41219105 intron probably benign
R5945:Gm5592 UTSW 7 41215612 intron probably benign
R6117:Gm5592 UTSW 7 41288464 missense probably benign 0.00
R6324:Gm5592 UTSW 7 41286535 missense probably damaging 0.98
R6449:Gm5592 UTSW 7 41288586 missense probably benign 0.09
R6571:Gm5592 UTSW 7 41288575 missense probably damaging 0.98
R6776:Gm5592 UTSW 7 41289729 missense probably damaging 1.00
R7595:Gm5592 UTSW 7 41286443 missense probably damaging 0.99
R7658:Gm5592 UTSW 7 41288710 missense probably benign 0.03
R7699:Gm5592 UTSW 7 41286407 missense probably damaging 1.00
R7700:Gm5592 UTSW 7 41286407 missense probably damaging 1.00
R7774:Gm5592 UTSW 7 41289859 missense probably damaging 1.00
R7788:Gm5592 UTSW 7 41286694 missense probably benign 0.01
R7890:Gm5592 UTSW 7 41286759 missense probably damaging 1.00
R8070:Gm5592 UTSW 7 41286463 missense possibly damaging 0.76
R8417:Gm5592 UTSW 7 41288551 missense probably benign 0.38
R8866:Gm5592 UTSW 7 41288822 missense possibly damaging 0.74
R9044:Gm5592 UTSW 7 41288850 missense probably benign 0.25
R9057:Gm5592 UTSW 7 41289463 missense possibly damaging 0.93
R9258:Gm5592 UTSW 7 41288983 missense possibly damaging 0.56
R9451:Gm5592 UTSW 7 41286452 missense probably damaging 0.99
R9760:Gm5592 UTSW 7 41289810 missense possibly damaging 0.57
X0021:Gm5592 UTSW 7 41288508 missense probably benign 0.01
Z1176:Gm5592 UTSW 7 41286317 missense probably damaging 1.00
Z1176:Gm5592 UTSW 7 41286319 missense possibly damaging 0.94
Z1176:Gm5592 UTSW 7 41288681 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGCTTCTACCATCAGCATCCAG -3'
(R):5'- GTAATAGACCTGGCTGCCTTC -3'

Sequencing Primer
(F):5'- GGGTAATGCCTATCTTAACCCACATG -3'
(R):5'- TCCTGGTAGGAAGGTGCCAG -3'
Posted On 2015-07-07