Incidental Mutation 'R2324:Zfp988'
ID328535
Institutional Source Beutler Lab
Gene Symbol Zfp988
Ensembl Gene ENSMUSG00000078498
Gene Namezinc finger protein 988
SynonymsGm13151
MMRRC Submission 040315-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.123) question?
Stock #R2324 (G1)
Quality Score20
Status Validated
Chromosome4
Chromosomal Location147305674-147333734 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 147332785 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamine at position 559 (K559Q)
Ref Sequence ENSEMBL: ENSMUSP00000120413 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000148762] [ENSMUST00000166764]
Predicted Effect probably benign
Transcript: ENSMUST00000148762
AA Change: K559Q

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000120413
Gene: ENSMUSG00000078498
AA Change: K559Q

DomainStartEndE-ValueType
KRAB 13 76 4.74e-16 SMART
ZnF_C2H2 240 262 2.61e-4 SMART
ZnF_C2H2 268 290 1.3e-4 SMART
ZnF_C2H2 296 318 9.73e-4 SMART
ZnF_C2H2 324 346 7.78e-3 SMART
ZnF_C2H2 352 374 1.3e-4 SMART
ZnF_C2H2 380 402 8.34e-3 SMART
ZnF_C2H2 408 430 2.79e-4 SMART
ZnF_C2H2 436 458 3.74e-5 SMART
ZnF_C2H2 464 486 1.3e-4 SMART
ZnF_C2H2 492 514 1.5e-4 SMART
ZnF_C2H2 520 542 2.43e-4 SMART
ZnF_C2H2 548 570 9.73e-4 SMART
ZnF_C2H2 576 598 1.56e-2 SMART
ZnF_C2H2 604 626 2.53e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000166764
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181084
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181486
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181752
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency 100% (33/33)
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akna T C 4: 63,371,802 D1223G possibly damaging Het
Ankrd42 C A 7: 92,623,978 R147L probably damaging Het
Apopt1 A G 12: 111,724,350 E112G possibly damaging Het
Cep152 T C 2: 125,563,462 I1717V probably benign Het
Clca3a2 A G 3: 144,806,280 probably null Het
Dnhd1 A T 7: 105,710,090 H3544L probably damaging Het
Dpy19l4 T C 4: 11,276,857 probably benign Het
Efcab8 A G 2: 153,783,809 probably null Het
Esyt2 A G 12: 116,367,821 N773S possibly damaging Het
Gm281 A T 14: 13,868,077 I204N probably damaging Het
Hectd4 G A 5: 121,315,437 G613D probably damaging Het
Ints12 G A 3: 133,109,365 M444I possibly damaging Het
Ints3 A G 3: 90,394,094 L827P probably damaging Het
Irf9 T C 14: 55,605,910 probably null Het
Lactb2 T C 1: 13,638,296 D176G probably damaging Het
Lmntd2 A T 7: 141,210,788 S516T possibly damaging Het
Lrp1 C A 10: 127,566,586 A2239S possibly damaging Het
Lrrc56 A G 7: 141,205,563 probably benign Het
Nfic A G 10: 81,406,087 probably null Het
Notch3 G A 17: 32,150,134 probably benign Het
Oas2 T C 5: 120,743,274 K251E probably benign Het
Olfr178 T C 16: 58,890,140 T27A probably benign Het
Pabpc4 T C 4: 123,297,778 probably benign Het
Piwil4 C T 9: 14,736,908 R125H possibly damaging Het
Rbsn A G 6: 92,193,966 Y325H probably damaging Het
Rhox2e C A X: 37,530,863 P69Q probably damaging Het
Skint6 T C 4: 112,872,457 probably null Het
Tmem165 T C 5: 76,204,824 probably benign Het
Tmem181a T A 17: 6,295,786 L185H probably damaging Het
Ttc13 A G 8: 124,679,057 V499A probably damaging Het
Vax2 G T 6: 83,711,325 R10L possibly damaging Het
Other mutations in Zfp988
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02282:Zfp988 APN 4 147331668 nonsense probably null
R1672:Zfp988 UTSW 4 147331282 missense probably benign
R1834:Zfp988 UTSW 4 147332887 missense probably damaging 0.97
R2380:Zfp988 UTSW 4 147332785 missense probably benign
R3795:Zfp988 UTSW 4 147331583 missense possibly damaging 0.51
R3945:Zfp988 UTSW 4 147332785 missense probably benign
R4024:Zfp988 UTSW 4 147332785 missense probably benign
R5012:Zfp988 UTSW 4 147331603 missense probably benign
R5059:Zfp988 UTSW 4 147331915 nonsense probably null
R6008:Zfp988 UTSW 4 147331802 missense probably benign 0.16
R6245:Zfp988 UTSW 4 147332013 nonsense probably null
R6549:Zfp988 UTSW 4 147331853 missense probably benign 0.03
R7658:Zfp988 UTSW 4 147332294 missense probably damaging 1.00
R8309:Zfp988 UTSW 4 147332308 missense probably damaging 0.99
R8439:Zfp988 UTSW 4 147332351 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ACCTTACAAATGCAATGAATGTGGC -3'
(R):5'- TCACTGTTACAGTCTAGGAAATAGGCC -3'

Sequencing Primer
(F):5'- GCAATGAATGTGGCAAATGCTTTAC -3'
(R):5'- TGAATACCAAGATGGAATTTTCGGG -3'
Posted On2015-07-15