Mutagenetix > Incidental Mutations

Incidental Mutation 'R4522:Ubqlnl'

334267

Institutional Source

Beutler Lab

Gene Symbol

Ubqlnl

Ensembl Gene

ENSMUSG00000051437

Gene Name

ubiquilin-like

Synonyms

LOC244179, 4922504M18Rik

MMRRC Submission

041765-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.143) question?

Stock #

R4522 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

104148259-104150556 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 104149718 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Methionine at position 191 (V191M)

Ref Sequence

ENSEMBL: ENSMUSP00000056365 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000051137] [ENSMUST00000059121] [ENSMUST00000154555]

PDB Structure

Solution Structure of RSGI RUH-056, a UBA domain from mouse cDNA [SOLUTION NMR]

Predicted Effect

probably benign
Transcript: ENSMUST00000051137

SMART Domains

Protein: ENSMUSP00000052174
Gene: ENSMUSG00000044265

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
coiled coil region	47	85	N/A	INTRINSIC
coiled coil region	157	198	N/A	INTRINSIC
OLF	211	468	3.13e-70	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000059121
AA Change: V191M

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000056365
Gene: ENSMUSG00000051437
AA Change: V191M

Domain	Start	End	E-Value	Type
UBQ	31	101	5.13e-16	SMART
Blast:STI1	199	237	8e-11	BLAST
low complexity region	339	350	N/A	INTRINSIC
low complexity region	402	419	N/A	INTRINSIC
PDB:2DNA\|A	561	610	3e-26	PDB
Blast:UBA	568	604	1e-10	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000154555

SMART Domains

Protein: ENSMUSP00000117893
Gene: ENSMUSG00000044265

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
coiled coil region	47	123	N/A	INTRINSIC
OLF	136	304	3.65e-10	SMART

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.9%
20x: 94.1%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice homozygous for a knock-out allele are viable and overtly normal in terms of growth and behavior. Adult males are fertile and show no apparent defects in spermatogenesis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 31 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ascc3	A	G	10: 50,660,670	N700D	probably benign	Het
Babam2	G	A	5: 32,007,242	V287M	probably damaging	Het
Brip1	T	C	11: 86,189,801	I146M	possibly damaging	Het
Cacna1b	C	T	2: 24,654,430	R1248H	probably damaging	Het
Ccdc88c	G	T	12: 100,913,332	S1843R	possibly damaging	Het
Chaf1b	G	A	16: 93,901,295	A485T	probably benign	Het
Dock7	T	C	4: 98,962,224	R1594G	probably damaging	Het
Fam122c	G	A	X: 53,293,499	R94H	possibly damaging	Het
Fbxo41	A	G	6: 85,484,042	I228T	probably damaging	Het
Gm3739	T	A	14: 7,299,398	K86*	probably null	Het
Gm7173	A	T	X: 79,509,995	N291K	possibly damaging	Het
Mark2	A	T	19: 7,285,948	D151E	probably damaging	Het
Nop2	G	T	6: 125,133,552	R47L	probably damaging	Het
Nwd1	A	T	8: 72,670,951	D606V	probably damaging	Het
Olfr1132	T	A	2: 87,635,151	I199L	probably benign	Het
Pcbp1	T	C	6: 86,525,050	N289S	probably benign	Het
Plce1	T	C	19: 38,524,319	S21P	possibly damaging	Het
Ptpn18	T	C	1: 34,472,960	L55P	probably benign	Het
Rpl10l	T	C	12: 66,283,738	D207G	probably benign	Het
Rufy4	T	C	1: 74,147,663	C537R	probably damaging	Het
Sec23b	T	A	2: 144,578,366	I450N	possibly damaging	Het
Speg	A	G	1: 75,428,330	E2922G	probably damaging	Het
Spem1	C	A	11: 69,821,805		probably null	Het
Stxbp3-ps	A	T	19: 9,559,110		noncoding transcript	Het
Tmem38a	C	T	8: 72,572,161	P20S	possibly damaging	Het
Tmod2	T	C	9: 75,592,584	T129A	probably benign	Het
Ttc28	A	G	5: 111,280,172	T1845A	probably benign	Het
Ush2a	C	T	1: 188,864,625	T3854M	probably damaging	Het
Vmn2r72	T	A	7: 85,751,926	H95L	probably benign	Het
Xdh	C	A	17: 73,898,344	G1042V	probably damaging	Het
Zfp105	T	A	9: 122,930,056	V264E	possibly damaging	Het

Other mutations in Ubqlnl

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00158:Ubqlnl	APN	7	104149165	missense	probably benign
IGL01592:Ubqlnl	APN	7	104150289	unclassified	probably benign
IGL01972:Ubqlnl	APN	7	104149697	missense	probably benign	0.00
IGL02266:Ubqlnl	APN	7	104149547	nonsense	probably null
IGL02447:Ubqlnl	APN	7	104148649	missense	probably damaging	1.00
IGL03232:Ubqlnl	APN	7	104148629	missense	possibly damaging	0.71
FR4737:Ubqlnl	UTSW	7	104149835	unclassified	probably benign
R0066:Ubqlnl	UTSW	7	104148938	missense	probably damaging	0.98
R0066:Ubqlnl	UTSW	7	104148938	missense	probably damaging	0.98
R0077:Ubqlnl	UTSW	7	104150047	missense	probably damaging	1.00
R0109:Ubqlnl	UTSW	7	104150192	missense	probably damaging	1.00
R0109:Ubqlnl	UTSW	7	104150192	missense	probably damaging	1.00
R0517:Ubqlnl	UTSW	7	104148638	missense	probably damaging	1.00
R1129:Ubqlnl	UTSW	7	104149650	missense	probably damaging	0.98
R1885:Ubqlnl	UTSW	7	104150065	missense	possibly damaging	0.88
R1987:Ubqlnl	UTSW	7	104148485	missense	probably benign
R2151:Ubqlnl	UTSW	7	104148683	missense	probably benign	0.00
R2152:Ubqlnl	UTSW	7	104148683	missense	probably benign	0.00
R2153:Ubqlnl	UTSW	7	104148683	missense	probably benign	0.00
R3712:Ubqlnl	UTSW	7	104149138	missense	probably benign	0.03
R3914:Ubqlnl	UTSW	7	104149606	missense	probably benign
R4367:Ubqlnl	UTSW	7	104149718	missense	probably benign	0.00
R4404:Ubqlnl	UTSW	7	104149718	missense	probably benign	0.00
R4405:Ubqlnl	UTSW	7	104149718	missense	probably benign	0.00
R4406:Ubqlnl	UTSW	7	104149718	missense	probably benign	0.00
R4407:Ubqlnl	UTSW	7	104149718	missense	probably benign	0.00
R4449:Ubqlnl	UTSW	7	104149718	missense	probably benign	0.00
R4458:Ubqlnl	UTSW	7	104149189	missense	probably benign	0.01
R4508:Ubqlnl	UTSW	7	104149718	missense	probably benign	0.00
R4516:Ubqlnl	UTSW	7	104149718	missense	probably benign	0.00
R4517:Ubqlnl	UTSW	7	104149718	missense	probably benign	0.00
R4518:Ubqlnl	UTSW	7	104149718	missense	probably benign	0.00
R4523:Ubqlnl	UTSW	7	104149718	missense	probably benign	0.00
R4524:Ubqlnl	UTSW	7	104149718	missense	probably benign	0.00
R4529:Ubqlnl	UTSW	7	104149718	missense	probably benign	0.00
R4531:Ubqlnl	UTSW	7	104149718	missense	probably benign	0.00
R4738:Ubqlnl	UTSW	7	104149718	missense	probably benign	0.00
R4739:Ubqlnl	UTSW	7	104149718	missense	probably benign	0.00
R4740:Ubqlnl	UTSW	7	104149718	missense	probably benign	0.00
R5339:Ubqlnl	UTSW	7	104149765	missense	probably benign	0.00
R5357:Ubqlnl	UTSW	7	104148931	missense	probably damaging	1.00
R5386:Ubqlnl	UTSW	7	104149217	missense	probably benign	0.01
R5542:Ubqlnl	UTSW	7	104149697	nonsense	probably null
R5588:Ubqlnl	UTSW	7	104149132	missense	probably damaging	1.00
R6058:Ubqlnl	UTSW	7	104148752	missense	probably benign
R6084:Ubqlnl	UTSW	7	104148698	missense	probably benign	0.01
R6207:Ubqlnl	UTSW	7	104148708	missense	possibly damaging	0.73
R6794:Ubqlnl	UTSW	7	104148785	missense	probably benign	0.34
R7500:Ubqlnl	UTSW	7	104148841	missense	probably damaging	1.00
R7575:Ubqlnl	UTSW	7	104148490	missense	probably damaging	1.00
Z1088:Ubqlnl	UTSW	7	104149993	missense	probably damaging	1.00
Z1177:Ubqlnl	UTSW	7	104148628	missense	probably damaging	0.96

Predicted Primers

PCR Primer
(F):5'- CCAAGAATGGCTGTGAGTTTG -3'
(R):5'- ATCCCTGCCATCAAGACAGG -3'

Sequencing Primer
(F):5'- AGTTTGGTGGATACTCAGGGTTC -3'
(R):5'- CCCTAAAGGAAATAGCAGCATG -3'

Posted On

2015-08-18