Incidental Mutation 'R4522:Ubqlnl'
ID334267
Institutional Source Beutler Lab
Gene Symbol Ubqlnl
Ensembl Gene ENSMUSG00000051437
Gene Nameubiquilin-like
SynonymsLOC244179, 4922504M18Rik
MMRRC Submission 041765-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.143) question?
Stock #R4522 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location104148259-104150556 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 104149718 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 191 (V191M)
Ref Sequence ENSEMBL: ENSMUSP00000056365 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051137] [ENSMUST00000059121] [ENSMUST00000154555]
PDB Structure
Solution Structure of RSGI RUH-056, a UBA domain from mouse cDNA [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000051137
SMART Domains Protein: ENSMUSP00000052174
Gene: ENSMUSG00000044265

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
coiled coil region 47 85 N/A INTRINSIC
coiled coil region 157 198 N/A INTRINSIC
OLF 211 468 3.13e-70 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000059121
AA Change: V191M

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000056365
Gene: ENSMUSG00000051437
AA Change: V191M

DomainStartEndE-ValueType
UBQ 31 101 5.13e-16 SMART
Blast:STI1 199 237 8e-11 BLAST
low complexity region 339 350 N/A INTRINSIC
low complexity region 402 419 N/A INTRINSIC
PDB:2DNA|A 561 610 3e-26 PDB
Blast:UBA 568 604 1e-10 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000154555
SMART Domains Protein: ENSMUSP00000117893
Gene: ENSMUSG00000044265

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
coiled coil region 47 123 N/A INTRINSIC
OLF 136 304 3.65e-10 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele are viable and overtly normal in terms of growth and behavior. Adult males are fertile and show no apparent defects in spermatogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ascc3 A G 10: 50,660,670 N700D probably benign Het
Babam2 G A 5: 32,007,242 V287M probably damaging Het
Brip1 T C 11: 86,189,801 I146M possibly damaging Het
Cacna1b C T 2: 24,654,430 R1248H probably damaging Het
Ccdc88c G T 12: 100,913,332 S1843R possibly damaging Het
Chaf1b G A 16: 93,901,295 A485T probably benign Het
Dock7 T C 4: 98,962,224 R1594G probably damaging Het
Fam122c G A X: 53,293,499 R94H possibly damaging Het
Fbxo41 A G 6: 85,484,042 I228T probably damaging Het
Gm3739 T A 14: 7,299,398 K86* probably null Het
Gm7173 A T X: 79,509,995 N291K possibly damaging Het
Mark2 A T 19: 7,285,948 D151E probably damaging Het
Nop2 G T 6: 125,133,552 R47L probably damaging Het
Nwd1 A T 8: 72,670,951 D606V probably damaging Het
Olfr1132 T A 2: 87,635,151 I199L probably benign Het
Pcbp1 T C 6: 86,525,050 N289S probably benign Het
Plce1 T C 19: 38,524,319 S21P possibly damaging Het
Ptpn18 T C 1: 34,472,960 L55P probably benign Het
Rpl10l T C 12: 66,283,738 D207G probably benign Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Sec23b T A 2: 144,578,366 I450N possibly damaging Het
Speg A G 1: 75,428,330 E2922G probably damaging Het
Spem1 C A 11: 69,821,805 probably null Het
Stxbp3-ps A T 19: 9,559,110 noncoding transcript Het
Tmem38a C T 8: 72,572,161 P20S possibly damaging Het
Tmod2 T C 9: 75,592,584 T129A probably benign Het
Ttc28 A G 5: 111,280,172 T1845A probably benign Het
Ush2a C T 1: 188,864,625 T3854M probably damaging Het
Vmn2r72 T A 7: 85,751,926 H95L probably benign Het
Xdh C A 17: 73,898,344 G1042V probably damaging Het
Zfp105 T A 9: 122,930,056 V264E possibly damaging Het
Other mutations in Ubqlnl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Ubqlnl APN 7 104149165 missense probably benign
IGL01592:Ubqlnl APN 7 104150289 unclassified probably benign
IGL01972:Ubqlnl APN 7 104149697 missense probably benign 0.00
IGL02266:Ubqlnl APN 7 104149547 nonsense probably null
IGL02447:Ubqlnl APN 7 104148649 missense probably damaging 1.00
IGL03232:Ubqlnl APN 7 104148629 missense possibly damaging 0.71
FR4737:Ubqlnl UTSW 7 104149835 unclassified probably benign
R0066:Ubqlnl UTSW 7 104148938 missense probably damaging 0.98
R0066:Ubqlnl UTSW 7 104148938 missense probably damaging 0.98
R0077:Ubqlnl UTSW 7 104150047 missense probably damaging 1.00
R0109:Ubqlnl UTSW 7 104150192 missense probably damaging 1.00
R0109:Ubqlnl UTSW 7 104150192 missense probably damaging 1.00
R0517:Ubqlnl UTSW 7 104148638 missense probably damaging 1.00
R1129:Ubqlnl UTSW 7 104149650 missense probably damaging 0.98
R1885:Ubqlnl UTSW 7 104150065 missense possibly damaging 0.88
R1987:Ubqlnl UTSW 7 104148485 missense probably benign
R2151:Ubqlnl UTSW 7 104148683 missense probably benign 0.00
R2152:Ubqlnl UTSW 7 104148683 missense probably benign 0.00
R2153:Ubqlnl UTSW 7 104148683 missense probably benign 0.00
R3712:Ubqlnl UTSW 7 104149138 missense probably benign 0.03
R3914:Ubqlnl UTSW 7 104149606 missense probably benign
R4367:Ubqlnl UTSW 7 104149718 missense probably benign 0.00
R4404:Ubqlnl UTSW 7 104149718 missense probably benign 0.00
R4405:Ubqlnl UTSW 7 104149718 missense probably benign 0.00
R4406:Ubqlnl UTSW 7 104149718 missense probably benign 0.00
R4407:Ubqlnl UTSW 7 104149718 missense probably benign 0.00
R4449:Ubqlnl UTSW 7 104149718 missense probably benign 0.00
R4458:Ubqlnl UTSW 7 104149189 missense probably benign 0.01
R4508:Ubqlnl UTSW 7 104149718 missense probably benign 0.00
R4516:Ubqlnl UTSW 7 104149718 missense probably benign 0.00
R4517:Ubqlnl UTSW 7 104149718 missense probably benign 0.00
R4518:Ubqlnl UTSW 7 104149718 missense probably benign 0.00
R4523:Ubqlnl UTSW 7 104149718 missense probably benign 0.00
R4524:Ubqlnl UTSW 7 104149718 missense probably benign 0.00
R4529:Ubqlnl UTSW 7 104149718 missense probably benign 0.00
R4531:Ubqlnl UTSW 7 104149718 missense probably benign 0.00
R4738:Ubqlnl UTSW 7 104149718 missense probably benign 0.00
R4739:Ubqlnl UTSW 7 104149718 missense probably benign 0.00
R4740:Ubqlnl UTSW 7 104149718 missense probably benign 0.00
R5339:Ubqlnl UTSW 7 104149765 missense probably benign 0.00
R5357:Ubqlnl UTSW 7 104148931 missense probably damaging 1.00
R5386:Ubqlnl UTSW 7 104149217 missense probably benign 0.01
R5542:Ubqlnl UTSW 7 104149697 nonsense probably null
R5588:Ubqlnl UTSW 7 104149132 missense probably damaging 1.00
R6058:Ubqlnl UTSW 7 104148752 missense probably benign
R6084:Ubqlnl UTSW 7 104148698 missense probably benign 0.01
R6207:Ubqlnl UTSW 7 104148708 missense possibly damaging 0.73
R6794:Ubqlnl UTSW 7 104148785 missense probably benign 0.34
R7500:Ubqlnl UTSW 7 104148841 missense probably damaging 1.00
R7575:Ubqlnl UTSW 7 104148490 missense probably damaging 1.00
Z1088:Ubqlnl UTSW 7 104149993 missense probably damaging 1.00
Z1177:Ubqlnl UTSW 7 104148628 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- CCAAGAATGGCTGTGAGTTTG -3'
(R):5'- ATCCCTGCCATCAAGACAGG -3'

Sequencing Primer
(F):5'- AGTTTGGTGGATACTCAGGGTTC -3'
(R):5'- CCCTAAAGGAAATAGCAGCATG -3'
Posted On2015-08-18