Incidental Mutation 'R4522:Babam2'
ID334261
Institutional Source Beutler Lab
Gene Symbol Babam2
Ensembl Gene ENSMUSG00000052139
Gene NameBRISC and BRCA1 A complex member 2
SynonymsBre, 6030405P19Rik, B830038C02Rik
MMRRC Submission 041765-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.823) question?
Stock #R4522 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location31697684-32084962 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 32007242 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 287 (V287M)
Ref Sequence ENSEMBL: ENSMUSP00000144205 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063813] [ENSMUST00000071531] [ENSMUST00000114507] [ENSMUST00000114515] [ENSMUST00000131995] [ENSMUST00000200705] [ENSMUST00000201352]
Predicted Effect probably damaging
Transcript: ENSMUST00000063813
AA Change: V324M

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000069133
Gene: ENSMUSG00000052139
AA Change: V324M

DomainStartEndE-ValueType
Pfam:BRE 70 370 3.4e-133 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000071531
AA Change: V278M

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000071462
Gene: ENSMUSG00000052139
AA Change: V278M

DomainStartEndE-ValueType
Pfam:BRE 28 324 2.2e-204 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000114507
AA Change: V223M

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000110152
Gene: ENSMUSG00000052139
AA Change: V223M

DomainStartEndE-ValueType
Pfam:BRE 3 269 9.5e-182 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000114515
AA Change: V287M

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000110160
Gene: ENSMUSG00000052139
AA Change: V287M

DomainStartEndE-ValueType
Pfam:BRE 1 333 4.9e-235 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000131995
AA Change: V149M

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000128351
Gene: ENSMUSG00000052139
AA Change: V149M

DomainStartEndE-ValueType
Pfam:BRE 1 195 4.3e-131 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000200705
SMART Domains Protein: ENSMUSP00000143964
Gene: ENSMUSG00000052139

DomainStartEndE-ValueType
Pfam:BRE 8 204 1.6e-72 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201107
Predicted Effect probably damaging
Transcript: ENSMUST00000201352
AA Change: V287M

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000144205
Gene: ENSMUSG00000052139
AA Change: V287M

DomainStartEndE-ValueType
Pfam:BRE 8 333 8.1e-146 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201542
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an anti-apoptotic, death receptor-associated protein that interacts with tumor necrosis factor-receptor-1. The encoded protein acts as an adapter in several protein complexes, including the BRCA1-A complex and the BRISC complex. The BRCA1-A complex possesses ubiquitinase activity and targets sites of double strand DNA breaks, while the BRISC complex exhibits deubiquitinase activity and is involved in mitotic spindle assembly. This gene is upregulated in several types of cancer. [provided by RefSeq, Jun 2016]
PHENOTYPE: Mice homozygous for a knock-out allele are fertile. However, fibroblasts exhibit decreased proliferation and increased cellular replicative senescence in response to irradiation and hydrogen peroxide with impaired DNA damage repair. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ascc3 A G 10: 50,660,670 N700D probably benign Het
Brip1 T C 11: 86,189,801 I146M possibly damaging Het
Cacna1b C T 2: 24,654,430 R1248H probably damaging Het
Ccdc88c G T 12: 100,913,332 S1843R possibly damaging Het
Chaf1b G A 16: 93,901,295 A485T probably benign Het
Dock7 T C 4: 98,962,224 R1594G probably damaging Het
Fam122c G A X: 53,293,499 R94H possibly damaging Het
Fbxo41 A G 6: 85,484,042 I228T probably damaging Het
Gm3739 T A 14: 7,299,398 K86* probably null Het
Gm7173 A T X: 79,509,995 N291K possibly damaging Het
Mark2 A T 19: 7,285,948 D151E probably damaging Het
Nop2 G T 6: 125,133,552 R47L probably damaging Het
Nwd1 A T 8: 72,670,951 D606V probably damaging Het
Olfr1132 T A 2: 87,635,151 I199L probably benign Het
Pcbp1 T C 6: 86,525,050 N289S probably benign Het
Plce1 T C 19: 38,524,319 S21P possibly damaging Het
Ptpn18 T C 1: 34,472,960 L55P probably benign Het
Rpl10l T C 12: 66,283,738 D207G probably benign Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Sec23b T A 2: 144,578,366 I450N possibly damaging Het
Speg A G 1: 75,428,330 E2922G probably damaging Het
Spem1 C A 11: 69,821,805 probably null Het
Stxbp3-ps A T 19: 9,559,110 noncoding transcript Het
Tmem38a C T 8: 72,572,161 P20S possibly damaging Het
Tmod2 T C 9: 75,592,584 T129A probably benign Het
Ttc28 A G 5: 111,280,172 T1845A probably benign Het
Ubqlnl C T 7: 104,149,718 V191M probably benign Het
Ush2a C T 1: 188,864,625 T3854M probably damaging Het
Vmn2r72 T A 7: 85,751,926 H95L probably benign Het
Xdh C A 17: 73,898,344 G1042V probably damaging Het
Zfp105 T A 9: 122,930,056 V264E possibly damaging Het
Other mutations in Babam2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00844:Babam2 APN 5 32007307 missense probably damaging 1.00
IGL01815:Babam2 APN 5 31702098 missense possibly damaging 0.90
IGL02869:Babam2 APN 5 32004772 missense possibly damaging 0.92
IGL03091:Babam2 APN 5 31785678 splice site probably null
IGL03185:Babam2 APN 5 31702032 missense possibly damaging 0.60
R1817:Babam2 UTSW 5 32057546 missense probably damaging 0.99
R4012:Babam2 UTSW 5 32001438 missense probably damaging 1.00
R4257:Babam2 UTSW 5 31702070 missense possibly damaging 0.76
R4622:Babam2 UTSW 5 32007312 missense probably damaging 0.99
R4738:Babam2 UTSW 5 31901142 missense probably damaging 0.99
R4752:Babam2 UTSW 5 31702047 intron probably benign
R4927:Babam2 UTSW 5 31702064 missense probably benign 0.00
R4962:Babam2 UTSW 5 31785583 missense possibly damaging 0.75
R5374:Babam2 UTSW 5 32007230 splice site probably benign
R5375:Babam2 UTSW 5 31701863 missense possibly damaging 0.52
R5453:Babam2 UTSW 5 32007246 missense probably damaging 1.00
R5890:Babam2 UTSW 5 32064807 intron probably benign
R5915:Babam2 UTSW 5 31785611 missense probably damaging 1.00
R5982:Babam2 UTSW 5 31820620 missense possibly damaging 0.86
R6271:Babam2 UTSW 5 32001362 missense probably damaging 1.00
R7268:Babam2 UTSW 5 31701853 missense probably damaging 1.00
R7352:Babam2 UTSW 5 32007250 nonsense probably null
R7422:Babam2 UTSW 5 31731049 splice site probably null
Predicted Primers PCR Primer
(F):5'- CTCATAACTGATGACTGATGTTTCC -3'
(R):5'- CTTCTGTGGGGCAACATCAC -3'

Sequencing Primer
(F):5'- ATTTCCTGCTAGATGAGGAAGC -3'
(R):5'- TCTGTGGGGCAACATCACATTAAAG -3'
Posted On2015-08-18