Incidental Mutation 'R4523:Ubqlnl'
ID334307
Institutional Source Beutler Lab
Gene Symbol Ubqlnl
Ensembl Gene ENSMUSG00000051437
Gene Nameubiquilin-like
SynonymsLOC244179, 4922504M18Rik
MMRRC Submission 042004-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.084) question?
Stock #R4523 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location104148259-104150556 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 104149718 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 191 (V191M)
Ref Sequence ENSEMBL: ENSMUSP00000056365 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051137] [ENSMUST00000059121] [ENSMUST00000154555]
PDB Structure
Solution Structure of RSGI RUH-056, a UBA domain from mouse cDNA [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000051137
SMART Domains Protein: ENSMUSP00000052174
Gene: ENSMUSG00000044265

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
coiled coil region 47 85 N/A INTRINSIC
coiled coil region 157 198 N/A INTRINSIC
OLF 211 468 3.13e-70 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000059121
AA Change: V191M

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000056365
Gene: ENSMUSG00000051437
AA Change: V191M

DomainStartEndE-ValueType
UBQ 31 101 5.13e-16 SMART
Blast:STI1 199 237 8e-11 BLAST
low complexity region 339 350 N/A INTRINSIC
low complexity region 402 419 N/A INTRINSIC
PDB:2DNA|A 561 610 3e-26 PDB
Blast:UBA 568 604 1e-10 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000154555
SMART Domains Protein: ENSMUSP00000117893
Gene: ENSMUSG00000044265

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
coiled coil region 47 123 N/A INTRINSIC
OLF 136 304 3.65e-10 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 100% (61/61)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele are viable and overtly normal in terms of growth and behavior. Adult males are fertile and show no apparent defects in spermatogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atp8a1 G T 5: 67,667,600 T796K probably benign Het
Atr T C 9: 95,862,863 S78P probably damaging Het
BC017643 A G 11: 121,224,108 probably benign Het
Calb2 C T 8: 110,148,509 probably null Het
Ccdc88c G T 12: 100,913,332 S1843R possibly damaging Het
Cdca7 A G 2: 72,479,698 S77G probably damaging Het
Cnot2 C T 10: 116,581,474 probably benign Het
Cstf2t T A 19: 31,083,082 V6D possibly damaging Het
Dido1 T C 2: 180,672,292 I852V probably damaging Het
Dmgdh C T 13: 93,688,630 Q154* probably null Het
Dnah12 T C 14: 26,770,022 F1138S probably damaging Het
Dnah12 G A 14: 26,876,958 A998T possibly damaging Het
Dusp5 T G 19: 53,537,601 Y225D probably damaging Het
Fam122c G A X: 53,293,499 R94H possibly damaging Het
Fam126a T C 5: 23,965,122 T410A probably benign Het
Fam193a G A 5: 34,443,371 D601N probably benign Het
Fbxo41 A G 6: 85,484,042 I228T probably damaging Het
Fmo2 T C 1: 162,887,708 K115R probably benign Het
Gak G T 5: 108,576,566 Q1093K probably benign Het
Gm5277 G T 3: 78,892,186 noncoding transcript Het
Gm7173 A T X: 79,509,995 N291K possibly damaging Het
Hgsnat A G 8: 25,968,361 probably null Het
Map3k3 G A 11: 106,148,868 R278H probably damaging Het
Mrvi1 T C 7: 110,923,841 M338V probably benign Het
Muc4 T C 16: 32,736,336 probably benign Het
Nectin3 C A 16: 46,448,590 R483L probably benign Het
Nop2 G T 6: 125,133,552 R47L probably damaging Het
Ntng1 A G 3: 109,934,996 S154P probably damaging Het
Olfml2b T C 1: 170,669,222 I474T probably benign Het
Olfr1054 C G 2: 86,333,300 D19H probably benign Het
Olfr843 T C 9: 19,249,229 T57A probably damaging Het
Optc G T 1: 133,903,754 T138K possibly damaging Het
Orc4 G A 2: 48,937,489 P31S probably benign Het
Pard3 C T 8: 127,398,627 P421S probably benign Het
Pcdhb22 G T 18: 37,520,421 E647D probably benign Het
Pclo A G 5: 14,679,992 probably benign Het
Prkce G T 17: 86,490,750 probably null Het
Prr12 T C 7: 45,048,523 D656G unknown Het
Ptprk A T 10: 28,466,052 D485V probably damaging Het
Ptprn2 T C 12: 116,876,000 L381P probably damaging Het
Rnf144b T C 13: 47,207,537 I51T probably benign Het
Rpl10l T C 12: 66,283,738 D207G probably benign Het
Sh3glb2 A T 2: 30,350,699 V118E probably damaging Het
Sipa1l2 C T 8: 125,492,424 G58D probably damaging Het
Slc5a4a C T 10: 76,148,362 A46V probably damaging Het
Tepp T A 8: 95,313,010 Y18* probably null Het
Tgm7 C A 2: 121,098,588 probably null Het
Tjap1 A G 17: 46,258,792 V424A probably benign Het
Trpm6 A T 19: 18,796,500 I414F probably damaging Het
Tsr3 C G 17: 25,241,749 D196E probably benign Het
Vmn2r72 T A 7: 85,751,926 H95L probably benign Het
Vmn2r97 T A 17: 18,929,071 N240K probably benign Het
Xdh C A 17: 73,898,344 G1042V probably damaging Het
Zcchc4 A G 5: 52,784,067 D68G probably damaging Het
Other mutations in Ubqlnl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Ubqlnl APN 7 104149165 missense probably benign
IGL01592:Ubqlnl APN 7 104150289 unclassified probably benign
IGL01972:Ubqlnl APN 7 104149697 missense probably benign 0.00
IGL02266:Ubqlnl APN 7 104149547 nonsense probably null
IGL02447:Ubqlnl APN 7 104148649 missense probably damaging 1.00
IGL03232:Ubqlnl APN 7 104148629 missense possibly damaging 0.71
FR4737:Ubqlnl UTSW 7 104149835 unclassified probably benign
R0066:Ubqlnl UTSW 7 104148938 missense probably damaging 0.98
R0066:Ubqlnl UTSW 7 104148938 missense probably damaging 0.98
R0077:Ubqlnl UTSW 7 104150047 missense probably damaging 1.00
R0109:Ubqlnl UTSW 7 104150192 missense probably damaging 1.00
R0109:Ubqlnl UTSW 7 104150192 missense probably damaging 1.00
R0517:Ubqlnl UTSW 7 104148638 missense probably damaging 1.00
R1129:Ubqlnl UTSW 7 104149650 missense probably damaging 0.98
R1885:Ubqlnl UTSW 7 104150065 missense possibly damaging 0.88
R1987:Ubqlnl UTSW 7 104148485 missense probably benign
R2151:Ubqlnl UTSW 7 104148683 missense probably benign 0.00
R2152:Ubqlnl UTSW 7 104148683 missense probably benign 0.00
R2153:Ubqlnl UTSW 7 104148683 missense probably benign 0.00
R3712:Ubqlnl UTSW 7 104149138 missense probably benign 0.03
R3914:Ubqlnl UTSW 7 104149606 missense probably benign
R4367:Ubqlnl UTSW 7 104149718 missense probably benign 0.00
R4404:Ubqlnl UTSW 7 104149718 missense probably benign 0.00
R4405:Ubqlnl UTSW 7 104149718 missense probably benign 0.00
R4406:Ubqlnl UTSW 7 104149718 missense probably benign 0.00
R4407:Ubqlnl UTSW 7 104149718 missense probably benign 0.00
R4449:Ubqlnl UTSW 7 104149718 missense probably benign 0.00
R4458:Ubqlnl UTSW 7 104149189 missense probably benign 0.01
R4508:Ubqlnl UTSW 7 104149718 missense probably benign 0.00
R4516:Ubqlnl UTSW 7 104149718 missense probably benign 0.00
R4517:Ubqlnl UTSW 7 104149718 missense probably benign 0.00
R4518:Ubqlnl UTSW 7 104149718 missense probably benign 0.00
R4522:Ubqlnl UTSW 7 104149718 missense probably benign 0.00
R4524:Ubqlnl UTSW 7 104149718 missense probably benign 0.00
R4529:Ubqlnl UTSW 7 104149718 missense probably benign 0.00
R4531:Ubqlnl UTSW 7 104149718 missense probably benign 0.00
R4738:Ubqlnl UTSW 7 104149718 missense probably benign 0.00
R4739:Ubqlnl UTSW 7 104149718 missense probably benign 0.00
R4740:Ubqlnl UTSW 7 104149718 missense probably benign 0.00
R5339:Ubqlnl UTSW 7 104149765 missense probably benign 0.00
R5357:Ubqlnl UTSW 7 104148931 missense probably damaging 1.00
R5386:Ubqlnl UTSW 7 104149217 missense probably benign 0.01
R5542:Ubqlnl UTSW 7 104149697 nonsense probably null
R5588:Ubqlnl UTSW 7 104149132 missense probably damaging 1.00
R6058:Ubqlnl UTSW 7 104148752 missense probably benign
R6084:Ubqlnl UTSW 7 104148698 missense probably benign 0.01
R6207:Ubqlnl UTSW 7 104148708 missense possibly damaging 0.73
R6794:Ubqlnl UTSW 7 104148785 missense probably benign 0.34
R7500:Ubqlnl UTSW 7 104148841 missense probably damaging 1.00
R7575:Ubqlnl UTSW 7 104148490 missense probably damaging 1.00
Z1088:Ubqlnl UTSW 7 104149993 missense probably damaging 1.00
Z1177:Ubqlnl UTSW 7 104148628 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- GGATACTCAGGGTTCTGTGC -3'
(R):5'- TGGTAACCAACAATCCCTGC -3'

Sequencing Primer
(F):5'- CTGGCTGCTGGATCTGCATTATC -3'
(R):5'- TCCCTGCCATCAAGACAGG -3'
Posted On2015-08-18