Incidental Mutation 'R4568:Trpv6'
ID341940
Institutional Source Beutler Lab
Gene Symbol Trpv6
Ensembl Gene ENSMUSG00000029868
Gene Nametransient receptor potential cation channel, subfamily V, member 6
SynonymsCAT, Ecac2, CaT1, Cac
MMRRC Submission 041792-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.098) question?
Stock #R4568 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location41620624-41636405 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 41626569 bp
ZygosityHeterozygous
Amino Acid Change Proline to Histidine at position 206 (P206H)
Ref Sequence ENSEMBL: ENSMUSP00000143854 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031902] [ENSMUST00000201471]
Predicted Effect probably damaging
Transcript: ENSMUST00000031902
AA Change: P206H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000031902
Gene: ENSMUSG00000029868
AA Change: P206H

DomainStartEndE-ValueType
ANK 44 74 2.39e2 SMART
ANK 78 107 6.17e-1 SMART
ANK 116 145 3.06e-5 SMART
ANK 162 191 1.85e-4 SMART
Blast:ANK 195 223 3e-10 BLAST
ANK 238 267 2.47e2 SMART
Pfam:Ion_trans 327 589 9.8e-18 PFAM
low complexity region 680 695 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194405
Predicted Effect probably damaging
Transcript: ENSMUST00000201471
AA Change: P206H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143854
Gene: ENSMUSG00000029868
AA Change: P206H

DomainStartEndE-ValueType
ANK 44 74 2.39e2 SMART
ANK 78 107 6.17e-1 SMART
ANK 116 145 3.06e-5 SMART
ANK 162 191 1.85e-4 SMART
Blast:ANK 195 223 3e-10 BLAST
ANK 238 267 2.47e2 SMART
Pfam:Ion_trans 327 589 9.8e-18 PFAM
low complexity region 680 695 N/A INTRINSIC
Meta Mutation Damage Score 0.2177 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 100% (36/36)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of multipass membrane proteins that functions as calcium channels. The encoded protein contains N-terminal ankyrin repeats, which are required for channel assembly and regulation. Translation initiation for this protein occurs at a non-AUG start codon that is decoded as methionine. This gene is situated next to a closely related gene for transient receptor potential cation channel subfamily V member 5 (TRPV5). This locus has experienced positive selection in non-African populations, resulting in several non-synonymous codon differences among individuals of different genetic backgrounds. [provided by RefSeq, Feb 2015]
PHENOTYPE: Mice homozygous for a knock-in allele exhibit impaired sperm motility and decreased fertilization by sperm. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm2 T A 7: 119,563,517 W5R probably benign Het
Bik T C 15: 83,541,444 probably null Het
Col6a1 A T 10: 76,719,197 probably benign Het
Crem A G 18: 3,299,175 I83T probably damaging Het
Csn1s1 G A 5: 87,680,904 V276I possibly damaging Het
Ctnna3 C T 10: 63,852,809 T344M possibly damaging Het
Dgcr8 G A 16: 18,280,394 P378S probably benign Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Fam208a A T 14: 27,476,701 probably null Het
Gpr139 C T 7: 119,144,805 V186M probably damaging Het
Krba1 A G 6: 48,409,723 T422A probably damaging Het
Lgals8 T G 13: 12,453,373 Y125S probably damaging Het
Map4k1 G A 7: 28,986,654 G107D probably damaging Het
Mfsd6 A T 1: 52,663,289 Y599* probably null Het
Olfr1411 A T 1: 92,597,391 M291L probably benign Het
Olfr412 A G 11: 74,365,209 E180G probably damaging Het
Omt2b T A 9: 78,328,247 probably benign Het
Pga5 A G 19: 10,671,852 Y235H probably damaging Het
Phldb2 T A 16: 45,777,718 K869* probably null Het
Pik3cb T C 9: 99,090,302 M268V probably benign Het
Pla2g4a T C 1: 149,842,226 D624G probably benign Het
Plxna4 T A 6: 32,152,938 I1817F probably damaging Het
Psmg3 A G 5: 139,826,249 I32T probably damaging Het
Ptpn4 T C 1: 119,680,059 E757G probably damaging Het
Rasl2-9 AGG A 7: 5,125,375 probably null Het
Ripply3 T A 16: 94,335,829 D116E probably damaging Het
Robo4 T C 9: 37,404,822 V263A possibly damaging Het
Slc5a9 C A 4: 111,891,744 probably null Het
Spef2 T C 15: 9,647,217 H1008R probably damaging Het
Stag1 T C 9: 100,848,669 V379A probably damaging Het
Tbc1d9 A G 8: 83,271,177 E1121G probably benign Het
Tpr T C 1: 150,392,959 probably benign Het
Vmn2r63 T C 7: 42,933,826 probably null Het
Vmn2r65 C T 7: 84,947,469 C126Y probably damaging Het
Other mutations in Trpv6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01878:Trpv6 APN 6 41626867 splice site probably benign
IGL02033:Trpv6 APN 6 41627617 splice site probably benign
IGL02439:Trpv6 APN 6 41625487 missense probably damaging 1.00
R0973:Trpv6 UTSW 6 41625188 missense probably benign 0.01
R0973:Trpv6 UTSW 6 41625188 missense probably benign 0.01
R0974:Trpv6 UTSW 6 41625188 missense probably benign 0.01
R1385:Trpv6 UTSW 6 41621129 missense probably benign 0.32
R1696:Trpv6 UTSW 6 41621768 missense possibly damaging 0.95
R2095:Trpv6 UTSW 6 41621756 missense probably damaging 0.99
R2287:Trpv6 UTSW 6 41626111 missense probably damaging 1.00
R2298:Trpv6 UTSW 6 41636076 missense possibly damaging 0.62
R2519:Trpv6 UTSW 6 41624616 nonsense probably null
R3522:Trpv6 UTSW 6 41627405 missense probably damaging 0.99
R4172:Trpv6 UTSW 6 41625498 missense probably damaging 1.00
R4397:Trpv6 UTSW 6 41625238 missense possibly damaging 0.82
R4571:Trpv6 UTSW 6 41621744 missense probably damaging 1.00
R5547:Trpv6 UTSW 6 41636154 missense possibly damaging 0.68
R6344:Trpv6 UTSW 6 41625422 splice site probably null
R6989:Trpv6 UTSW 6 41625456 missense probably damaging 1.00
R7427:Trpv6 UTSW 6 41625153 missense probably benign
R7445:Trpv6 UTSW 6 41621342 missense probably damaging 1.00
R7538:Trpv6 UTSW 6 41626167 missense probably benign 0.01
R7960:Trpv6 UTSW 6 41627678 missense probably benign 0.00
R8059:Trpv6 UTSW 6 41624586 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGTTCCCTGGTGACTCATTC -3'
(R):5'- GTTCAAAACTTAGGGCCAGGGG -3'

Sequencing Primer
(F):5'- GGTGACTCATTCTCCATCAGAG -3'
(R):5'- CCAGGGGCCAGTTTCCC -3'
Posted On2015-09-24