Mutagenetix > Incidental Mutations

Incidental Mutation 'R4568:Phldb2'

341959

Institutional Source

Beutler Lab

Gene Symbol

Phldb2

Ensembl Gene

ENSMUSG00000033149

Gene Name

pleckstrin homology like domain, family B, member 2

Synonyms

LL5b, LL5beta, C820004H04Rik

MMRRC Submission

041792-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4568 (G1)

Quality Score

207

Status

Validated

Chromosome

Chromosomal Location

45746243-45953598 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

T to A at 45777718 bp

Zygosity

Heterozygous

Amino Acid Change

Lysine to Stop codon at position 869 (K869*)

Ref Sequence

ENSEMBL: ENSMUSP00000123284 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000036355] [ENSMUST00000076333] [ENSMUST00000134802] [ENSMUST00000142697]

Predicted Effect

probably null
Transcript: ENSMUST00000036355
AA Change: K824*

SMART Domains

Protein: ENSMUSP00000046496
Gene: ENSMUSG00000033149
AA Change: K824*

Domain	Start	End	E-Value	Type
low complexity region	267	283	N/A	INTRINSIC
low complexity region	426	447	N/A	INTRINSIC
coiled coil region	580	692	N/A	INTRINSIC
coiled coil region	724	800	N/A	INTRINSIC
coiled coil region	1027	1097	N/A	INTRINSIC
PH	1140	1244	6.45e-17	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000076333
AA Change: K824*

SMART Domains

Protein: ENSMUSP00000075672
Gene: ENSMUSG00000033149
AA Change: K824*

Domain	Start	End	E-Value	Type
low complexity region	267	283	N/A	INTRINSIC
low complexity region	426	447	N/A	INTRINSIC
coiled coil region	580	692	N/A	INTRINSIC
coiled coil region	724	800	N/A	INTRINSIC
low complexity region	901	913	N/A	INTRINSIC
coiled coil region	1080	1150	N/A	INTRINSIC
PH	1193	1297	6.45e-17	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000131003
AA Change: K187*

SMART Domains

Protein: ENSMUSP00000119718
Gene: ENSMUSG00000033149
AA Change: K187*

Domain	Start	End	E-Value	Type
coiled coil region	1	55	N/A	INTRINSIC
coiled coil region	87	163	N/A	INTRINSIC
coiled coil region	342	412	N/A	INTRINSIC
PH	456	560	6.45e-17	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000133111

Predicted Effect

probably null
Transcript: ENSMUST00000134802
AA Change: K869*

SMART Domains

Protein: ENSMUSP00000123284
Gene: ENSMUSG00000033149
AA Change: K869*

Domain	Start	End	E-Value	Type
low complexity region	20	28	N/A	INTRINSIC
low complexity region	312	328	N/A	INTRINSIC
low complexity region	471	492	N/A	INTRINSIC
coiled coil region	625	737	N/A	INTRINSIC
coiled coil region	769	845	N/A	INTRINSIC
coiled coil region	1072	1131	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000142697

SMART Domains

Protein: ENSMUSP00000121981
Gene: ENSMUSG00000033149

Domain	Start	End	E-Value	Type
SCOP:d1k4wa_	25	116	5e-3	SMART

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.3%
20x: 95.1%

Validation Efficiency

100% (36/36)

Allele List at MGI

Other mutations in this stock

Total: 34 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acsm2	T	A	7: 119,563,517	W5R	probably benign	Het
Bik	T	C	15: 83,541,444		probably null	Het
Col6a1	A	T	10: 76,719,197		probably benign	Het
Crem	A	G	18: 3,299,175	I83T	probably damaging	Het
Csn1s1	G	A	5: 87,680,904	V276I	possibly damaging	Het
Ctnna3	C	T	10: 63,852,809	T344M	possibly damaging	Het
Dgcr8	G	A	16: 18,280,394	P378S	probably benign	Het
Dnah8	G	A	17: 30,748,568	D2585N	probably benign	Het
Fam208a	A	T	14: 27,476,701		probably null	Het
Gpr139	C	T	7: 119,144,805	V186M	probably damaging	Het
Krba1	A	G	6: 48,409,723	T422A	probably damaging	Het
Lgals8	T	G	13: 12,453,373	Y125S	probably damaging	Het
Map4k1	G	A	7: 28,986,654	G107D	probably damaging	Het
Mfsd6	A	T	1: 52,663,289	Y599*	probably null	Het
Olfr1411	A	T	1: 92,597,391	M291L	probably benign	Het
Olfr412	A	G	11: 74,365,209	E180G	probably damaging	Het
Omt2b	T	A	9: 78,328,247		probably benign	Het
Pga5	A	G	19: 10,671,852	Y235H	probably damaging	Het
Pik3cb	T	C	9: 99,090,302	M268V	probably benign	Het
Pla2g4a	T	C	1: 149,842,226	D624G	probably benign	Het
Plxna4	T	A	6: 32,152,938	I1817F	probably damaging	Het
Psmg3	A	G	5: 139,826,249	I32T	probably damaging	Het
Ptpn4	T	C	1: 119,680,059	E757G	probably damaging	Het
Rasl2-9	AGG	A	7: 5,125,375		probably null	Het
Ripply3	T	A	16: 94,335,829	D116E	probably damaging	Het
Robo4	T	C	9: 37,404,822	V263A	possibly damaging	Het
Slc5a9	C	A	4: 111,891,744		probably null	Het
Spef2	T	C	15: 9,647,217	H1008R	probably damaging	Het
Stag1	T	C	9: 100,848,669	V379A	probably damaging	Het
Tbc1d9	A	G	8: 83,271,177	E1121G	probably benign	Het
Tpr	T	C	1: 150,392,959		probably benign	Het
Trpv6	G	T	6: 41,626,569	P206H	probably damaging	Het
Vmn2r63	T	C	7: 42,933,826		probably null	Het
Vmn2r65	C	T	7: 84,947,469	C126Y	probably damaging	Het

Other mutations in Phldb2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00321:Phldb2	APN	16	45772254	missense	probably damaging	1.00
IGL00485:Phldb2	APN	16	45757188	missense	possibly damaging	0.75
IGL00544:Phldb2	APN	16	45825311	missense	probably damaging	1.00
IGL00547:Phldb2	APN	16	45825535	missense	probably benign	0.00
IGL00835:Phldb2	APN	16	45751456	missense	probably damaging	1.00
IGL00987:Phldb2	APN	16	45763102	missense	possibly damaging	0.78
IGL01102:Phldb2	APN	16	45825060	missense	probably damaging	1.00
IGL01530:Phldb2	APN	16	45802729	missense	probably damaging	1.00
IGL01549:Phldb2	APN	16	45774318	missense	probably benign	0.00
IGL01712:Phldb2	APN	16	45751429	missense	probably damaging	1.00
IGL01755:Phldb2	APN	16	45825582	missense	probably damaging	0.96
IGL01823:Phldb2	APN	16	45825144	missense	probably damaging	0.97
IGL02353:Phldb2	APN	16	45748779	missense	probably damaging	1.00
IGL02360:Phldb2	APN	16	45748779	missense	probably damaging	1.00
IGL02716:Phldb2	APN	16	45801590	missense	probably damaging	0.99
R0139:Phldb2	UTSW	16	45770666	splice site	probably benign
R0312:Phldb2	UTSW	16	45789047	missense	probably damaging	1.00
R0379:Phldb2	UTSW	16	45781451	missense	probably damaging	1.00
R0535:Phldb2	UTSW	16	45757127	missense	probably damaging	1.00
R1387:Phldb2	UTSW	16	45825994	missense	possibly damaging	0.69
R1444:Phldb2	UTSW	16	45757253	splice site	probably benign
R1487:Phldb2	UTSW	16	45789024	missense	probably damaging	1.00
R1501:Phldb2	UTSW	16	45777783	missense	probably damaging	1.00
R1605:Phldb2	UTSW	16	45770779	splice site	probably benign
R1716:Phldb2	UTSW	16	45775050	missense	probably benign	0.01
R1732:Phldb2	UTSW	16	45757166	missense	probably damaging	1.00
R1779:Phldb2	UTSW	16	45801625	missense	probably damaging	1.00
R1824:Phldb2	UTSW	16	45826011	missense	probably benign	0.14
R2001:Phldb2	UTSW	16	45774195	missense	possibly damaging	0.66
R2066:Phldb2	UTSW	16	45770758	missense	probably damaging	1.00
R2122:Phldb2	UTSW	16	45762941	missense	probably damaging	0.99
R2448:Phldb2	UTSW	16	45825363	missense	probably damaging	1.00
R2932:Phldb2	UTSW	16	45748785	missense	possibly damaging	0.85
R3076:Phldb2	UTSW	16	45825010	missense	probably benign	0.00
R3078:Phldb2	UTSW	16	45825010	missense	probably benign	0.00
R3779:Phldb2	UTSW	16	45748755	missense	probably damaging	1.00
R3914:Phldb2	UTSW	16	45757163	missense	probably damaging	1.00
R4536:Phldb2	UTSW	16	45770681	missense	probably benign	0.04
R4798:Phldb2	UTSW	16	45825874	missense	probably damaging	1.00
R4853:Phldb2	UTSW	16	45802716	missense	probably damaging	0.99
R4906:Phldb2	UTSW	16	45751395	missense	probably damaging	1.00
R4984:Phldb2	UTSW	16	45825633	missense	probably damaging	1.00
R5078:Phldb2	UTSW	16	45777742	missense	possibly damaging	0.85
R5137:Phldb2	UTSW	16	45808258	missense	possibly damaging	0.85
R5237:Phldb2	UTSW	16	45747886	missense	probably damaging	0.99
R5410:Phldb2	UTSW	16	45825612	missense	possibly damaging	0.77
R5825:Phldb2	UTSW	16	45763097	missense	probably benign	0.11
R5874:Phldb2	UTSW	16	45801625	missense	probably damaging	1.00
R5907:Phldb2	UTSW	16	45825188	missense	probably damaging	1.00
R6332:Phldb2	UTSW	16	45774246	missense	probably benign
R6354:Phldb2	UTSW	16	45825114	missense	probably damaging	1.00
R6355:Phldb2	UTSW	16	45825338	missense	probably damaging	0.99
R6383:Phldb2	UTSW	16	45748750	missense	probably damaging	1.00
R6463:Phldb2	UTSW	16	45774993	missense	probably benign	0.37
R6513:Phldb2	UTSW	16	45747877	missense	possibly damaging	0.96
R6593:Phldb2	UTSW	16	45825427	nonsense	probably null
R6756:Phldb2	UTSW	16	45808320	missense	probably benign	0.02
R6810:Phldb2	UTSW	16	45748725	critical splice donor site	probably null
R6897:Phldb2	UTSW	16	45777775	missense	probably damaging	1.00
R7010:Phldb2	UTSW	16	45751505	missense	probably damaging	0.99
R7142:Phldb2	UTSW	16	45757176	nonsense	probably null
R7149:Phldb2	UTSW	16	45751532	nonsense	probably null
R7249:Phldb2	UTSW	16	45801614	missense	probably damaging	1.00
R7300:Phldb2	UTSW	16	45825562	missense	probably damaging	1.00
R7328:Phldb2	UTSW	16	45758209	critical splice acceptor site	probably null
R7515:Phldb2	UTSW	16	45774240	missense	possibly damaging	0.90
R7840:Phldb2	UTSW	16	45751364	missense	probably damaging	1.00
R7988:Phldb2	UTSW	16	45825571	missense	probably benign	0.03
R8159:Phldb2	UTSW	16	45860384	missense	possibly damaging	0.82
R8353:Phldb2	UTSW	16	45825022	missense	probably benign	0.00
R8453:Phldb2	UTSW	16	45825022	missense	probably benign	0.00
RF008:Phldb2	UTSW	16	45762974	missense	probably damaging	1.00
Z1176:Phldb2	UTSW	16	45825826	missense	probably benign	0.43
Z1176:Phldb2	UTSW	16	45825827	missense	probably benign	0.04
Z1176:Phldb2	UTSW	16	45953508	unclassified	probably benign
Z1190:Phldb2	UTSW	16	45825334	missense	probably damaging	0.96

Predicted Primers

PCR Primer
(F):5'- TAGACGTGTCTTGGCTCACAC -3'
(R):5'- CGATGTTTGGCTCTAATGCAG -3'

Sequencing Primer
(F):5'- GTGTCTTGGCTCACACAAACATGG -3'
(R):5'- TGGCTCTAATGCAGTCAGC -3'

Posted On

2015-09-24