Incidental Mutation 'R4594:Rdh14'
ID 344276
Institutional Source Beutler Lab
Gene Symbol Rdh14
Ensembl Gene ENSMUSG00000020621
Gene Name retinol dehydrogenase 14 (all-trans and 9-cis)
Synonyms PAN2
MMRRC Submission 041810-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock # R4594 (G1)
Quality Score 225
Status Validated
Chromosome 12
Chromosomal Location 10390772-10395562 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 10394567 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 139 (N139K)
Ref Sequence ENSEMBL: ENSMUSP00000020947 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002456] [ENSMUST00000020947] [ENSMUST00000118657] [ENSMUST00000147323] [ENSMUST00000217944] [ENSMUST00000218026] [ENSMUST00000218287] [ENSMUST00000218327] [ENSMUST00000218339] [ENSMUST00000218417] [ENSMUST00000220611] [ENSMUST00000218551] [ENSMUST00000219049] [ENSMUST00000220257] [ENSMUST00000219826] [ENSMUST00000223534] [ENSMUST00000219292]
AlphaFold Q9ERI6
Predicted Effect probably benign
Transcript: ENSMUST00000002456
SMART Domains Protein: ENSMUSP00000002456
Gene: ENSMUSG00000020622

DomainStartEndE-ValueType
low complexity region 93 105 N/A INTRINSIC
low complexity region 137 145 N/A INTRINSIC
low complexity region 227 233 N/A INTRINSIC
Pfam:5-nucleotidase 298 570 1.6e-106 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000020947
AA Change: N139K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000020947
Gene: ENSMUSG00000020621
AA Change: N139K

DomainStartEndE-ValueType
transmembrane domain 2 21 N/A INTRINSIC
Pfam:KR 45 199 3.4e-10 PFAM
Pfam:adh_short 45 258 5.4e-34 PFAM
Pfam:Epimerase 47 248 7.6e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000118657
SMART Domains Protein: ENSMUSP00000112694
Gene: ENSMUSG00000020622

DomainStartEndE-ValueType
low complexity region 91 103 N/A INTRINSIC
low complexity region 135 143 N/A INTRINSIC
low complexity region 225 231 N/A INTRINSIC
Pfam:5-nucleotidase 280 553 7e-112 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000147323
SMART Domains Protein: ENSMUSP00000117869
Gene: ENSMUSG00000020622

DomainStartEndE-ValueType
low complexity region 93 105 N/A INTRINSIC
low complexity region 137 145 N/A INTRINSIC
low complexity region 227 233 N/A INTRINSIC
Pfam:5-nucleotidase 298 466 4.8e-62 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000217944
Predicted Effect probably benign
Transcript: ENSMUST00000218026
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218148
Predicted Effect probably benign
Transcript: ENSMUST00000218287
Predicted Effect probably benign
Transcript: ENSMUST00000218288
Predicted Effect probably benign
Transcript: ENSMUST00000218327
Predicted Effect probably benign
Transcript: ENSMUST00000218339
Predicted Effect probably benign
Transcript: ENSMUST00000218417
Predicted Effect probably benign
Transcript: ENSMUST00000220611
Predicted Effect probably benign
Transcript: ENSMUST00000218551
Predicted Effect probably benign
Transcript: ENSMUST00000219049
Predicted Effect probably benign
Transcript: ENSMUST00000220257
Predicted Effect probably benign
Transcript: ENSMUST00000219630
Predicted Effect probably benign
Transcript: ENSMUST00000219826
Predicted Effect probably benign
Transcript: ENSMUST00000223534
Predicted Effect probably benign
Transcript: ENSMUST00000219292
Meta Mutation Damage Score 0.9124 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 100% (66/66)
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700109H08Rik A G 5: 3,575,754 T64A probably damaging Het
4933427I04Rik A T 4: 123,860,538 T82S possibly damaging Het
Adamts15 A T 9: 30,921,447 I264N probably damaging Het
Alpk1 G A 3: 127,683,554 A285V probably damaging Het
Auh T C 13: 52,912,966 probably benign Het
BC030499 T A 11: 78,291,647 V94D possibly damaging Het
Cacna2d3 A G 14: 28,982,346 F826S probably benign Het
Ccdc54 G T 16: 50,590,017 Y295* probably null Het
Ctnna3 G A 10: 64,586,079 V551I probably benign Het
Diaph3 C T 14: 86,986,037 C347Y probably damaging Het
Dnajb5 A G 4: 42,950,842 probably benign Het
Dscam A T 16: 96,717,996 I847K possibly damaging Het
Fam8a1 T C 13: 46,671,266 F243S probably damaging Het
Fat2 T C 11: 55,284,752 I1712V possibly damaging Het
Fgfr1 T C 8: 25,573,836 V793A probably damaging Het
Got2 T C 8: 95,872,186 E196G probably benign Het
Gsk3b G A 16: 38,170,701 C107Y possibly damaging Het
H2-M5 T C 17: 36,987,805 T250A possibly damaging Het
Il17f T A 1: 20,777,802 T151S probably damaging Het
Ints12 A G 3: 133,108,868 N279D probably benign Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Kynu T A 2: 43,679,890 S395T probably benign Het
Llgl1 C T 11: 60,706,321 T226I probably benign Het
Mael T A 1: 166,235,487 Q132L probably damaging Het
Mcpt1 A T 14: 56,018,652 R49S probably benign Het
Meioc G T 11: 102,674,166 G203C probably damaging Het
Mfsd4b1 A G 10: 40,007,317 S46P probably benign Het
Muc6 G T 7: 141,638,772 T1996N possibly damaging Het
Mx2 C A 16: 97,547,432 Y268* probably null Het
Myom1 A G 17: 71,100,074 D1064G possibly damaging Het
Nek11 A G 9: 105,392,847 probably null Het
Nfe2 A G 15: 103,248,805 L253S probably damaging Het
Nup205 T C 6: 35,196,489 I478T probably benign Het
Nxpe2 T C 9: 48,319,482 D529G probably damaging Het
Oard1 T C 17: 48,415,239 S88P possibly damaging Het
Olfr1370 C T 13: 21,072,522 V260I probably benign Het
Olfr231 G T 1: 174,117,320 T232N probably damaging Het
Olfr639 T C 7: 104,012,417 D95G probably benign Het
Olfr678 T C 7: 105,069,590 V41A probably benign Het
Olfr732 G A 14: 50,281,683 T190I probably benign Het
Olfr741 A G 14: 50,486,162 R235G probably benign Het
Olfr906 A C 9: 38,488,761 H244P probably damaging Het
Osgin1 C T 8: 119,445,253 T262I possibly damaging Het
Plcb4 A T 2: 136,002,599 M146L probably damaging Het
Prkdc A T 16: 15,767,966 E2456V possibly damaging Het
Ptk2 G A 15: 73,206,196 A1004V probably damaging Het
Rab15 G A 12: 76,800,671 probably benign Het
Rad51ap2 T C 12: 11,457,880 V601A probably benign Het
Rasef T A 4: 73,780,389 I12F possibly damaging Het
Rexo2 A T 9: 48,480,417 V46E probably damaging Het
Slmap A T 14: 26,465,617 L68H probably damaging Het
Speer3 C G 5: 13,796,380 A238G possibly damaging Het
Tmem132e T C 11: 82,435,068 I206T possibly damaging Het
Trappc8 A T 18: 20,836,948 V995E probably benign Het
Vmn2r12 A C 5: 109,086,435 I637S probably damaging Het
Vmn2r124 T C 17: 18,073,969 F773L probably damaging Het
Vmn2r99 A T 17: 19,393,662 D548V probably damaging Het
Wdr81 T C 11: 75,445,794 N1590D probably benign Het
Zbtb6 A T 2: 37,429,042 N291K possibly damaging Het
Zfp119a G A 17: 55,866,325 R173C probably benign Het
Zmynd15 T C 11: 70,464,182 L335P probably damaging Het
Other mutations in Rdh14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00264:Rdh14 APN 12 10391134 missense probably damaging 0.98
IGL00928:Rdh14 APN 12 10394803 missense probably damaging 1.00
IGL02207:Rdh14 APN 12 10394712 missense possibly damaging 0.81
H8562:Rdh14 UTSW 12 10394709 missense probably damaging 1.00
R1521:Rdh14 UTSW 12 10394613 missense probably damaging 1.00
R1943:Rdh14 UTSW 12 10391162 missense probably benign 0.09
R3980:Rdh14 UTSW 12 10394703 missense probably benign 0.04
R4289:Rdh14 UTSW 12 10394949 missense probably benign 0.00
R4414:Rdh14 UTSW 12 10391231 splice site probably null
R4415:Rdh14 UTSW 12 10391231 splice site probably null
R4417:Rdh14 UTSW 12 10391231 splice site probably null
R5397:Rdh14 UTSW 12 10394869 missense probably damaging 0.99
R6618:Rdh14 UTSW 12 10395123 missense probably benign 0.24
R8088:Rdh14 UTSW 12 10394551 missense probably damaging 1.00
R8418:Rdh14 UTSW 12 10394580 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- GACAGTGCTTCAAATAGTTCCCAG -3'
(R):5'- GTTTGCTTCGACTATAACAGAAGC -3'

Sequencing Primer
(F):5'- GTGCTTCAAATAGTTCCCAGATAAAC -3'
(R):5'- GCTCACTGTTCAAGTCTTCAAAG -3'
Posted On 2015-09-25