Incidental Mutation 'R4594:Il17f'
ID 344240
Institutional Source Beutler Lab
Gene Symbol Il17f
Ensembl Gene ENSMUSG00000041872
Gene Name interleukin 17F
Synonyms
MMRRC Submission 041810-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.095) question?
Stock # R4594 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 20777146-20790617 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 20777802 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Serine at position 151 (T151S)
Ref Sequence ENSEMBL: ENSMUSP00000046960 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039046] [ENSMUST00000189301]
AlphaFold Q7TNI7
Predicted Effect probably damaging
Transcript: ENSMUST00000039046
AA Change: T151S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000046960
Gene: ENSMUSG00000041872
AA Change: T151S

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:IL17 75 153 3.8e-32 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000189301
AA Change: T151S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000140122
Gene: ENSMUSG00000041872
AA Change: T151S

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:IL17 74 154 5.4e-33 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191111
Meta Mutation Damage Score 0.5291 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a cytokine that shares sequence similarity with IL17. This cytokine is expressed by activated T cells, and has been shown to stimulate the production of several other cytokines, including IL6, IL8, and CSF2/GM_CSF. This cytokine is also found to inhibit the angiogenesis of endothelial cells and induce endothelial cells to produce IL2, TGFB1/TGFB, and monocyte chemoattractant protein-1. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for one null allele exhibit increased susceptibility to oral bacterial infection while mice homozygous for another null allele exhibit decreased susceptibility to experimental models of colitis and CNS inflammation but have enhanced inflammatory responses to a chronic asthma model. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700109H08Rik A G 5: 3,575,754 T64A probably damaging Het
4933427I04Rik A T 4: 123,860,538 T82S possibly damaging Het
Adamts15 A T 9: 30,921,447 I264N probably damaging Het
Alpk1 G A 3: 127,683,554 A285V probably damaging Het
Auh T C 13: 52,912,966 probably benign Het
BC030499 T A 11: 78,291,647 V94D possibly damaging Het
Cacna2d3 A G 14: 28,982,346 F826S probably benign Het
Ccdc54 G T 16: 50,590,017 Y295* probably null Het
Ctnna3 G A 10: 64,586,079 V551I probably benign Het
Diaph3 C T 14: 86,986,037 C347Y probably damaging Het
Dnajb5 A G 4: 42,950,842 probably benign Het
Dscam A T 16: 96,717,996 I847K possibly damaging Het
Fam8a1 T C 13: 46,671,266 F243S probably damaging Het
Fat2 T C 11: 55,284,752 I1712V possibly damaging Het
Fgfr1 T C 8: 25,573,836 V793A probably damaging Het
Got2 T C 8: 95,872,186 E196G probably benign Het
Gsk3b G A 16: 38,170,701 C107Y possibly damaging Het
H2-M5 T C 17: 36,987,805 T250A possibly damaging Het
Ints12 A G 3: 133,108,868 N279D probably benign Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Kynu T A 2: 43,679,890 S395T probably benign Het
Llgl1 C T 11: 60,706,321 T226I probably benign Het
Mael T A 1: 166,235,487 Q132L probably damaging Het
Mcpt1 A T 14: 56,018,652 R49S probably benign Het
Meioc G T 11: 102,674,166 G203C probably damaging Het
Mfsd4b1 A G 10: 40,007,317 S46P probably benign Het
Muc6 G T 7: 141,638,772 T1996N possibly damaging Het
Mx2 C A 16: 97,547,432 Y268* probably null Het
Myom1 A G 17: 71,100,074 D1064G possibly damaging Het
Nek11 A G 9: 105,392,847 probably null Het
Nfe2 A G 15: 103,248,805 L253S probably damaging Het
Nup205 T C 6: 35,196,489 I478T probably benign Het
Nxpe2 T C 9: 48,319,482 D529G probably damaging Het
Oard1 T C 17: 48,415,239 S88P possibly damaging Het
Olfr1370 C T 13: 21,072,522 V260I probably benign Het
Olfr231 G T 1: 174,117,320 T232N probably damaging Het
Olfr639 T C 7: 104,012,417 D95G probably benign Het
Olfr678 T C 7: 105,069,590 V41A probably benign Het
Olfr732 G A 14: 50,281,683 T190I probably benign Het
Olfr741 A G 14: 50,486,162 R235G probably benign Het
Olfr906 A C 9: 38,488,761 H244P probably damaging Het
Osgin1 C T 8: 119,445,253 T262I possibly damaging Het
Plcb4 A T 2: 136,002,599 M146L probably damaging Het
Prkdc A T 16: 15,767,966 E2456V possibly damaging Het
Ptk2 G A 15: 73,206,196 A1004V probably damaging Het
Rab15 G A 12: 76,800,671 probably benign Het
Rad51ap2 T C 12: 11,457,880 V601A probably benign Het
Rasef T A 4: 73,780,389 I12F possibly damaging Het
Rdh14 T A 12: 10,394,567 N139K probably damaging Het
Rexo2 A T 9: 48,480,417 V46E probably damaging Het
Slmap A T 14: 26,465,617 L68H probably damaging Het
Speer3 C G 5: 13,796,380 A238G possibly damaging Het
Tmem132e T C 11: 82,435,068 I206T possibly damaging Het
Trappc8 A T 18: 20,836,948 V995E probably benign Het
Vmn2r12 A C 5: 109,086,435 I637S probably damaging Het
Vmn2r124 T C 17: 18,073,969 F773L probably damaging Het
Vmn2r99 A T 17: 19,393,662 D548V probably damaging Het
Wdr81 T C 11: 75,445,794 N1590D probably benign Het
Zbtb6 A T 2: 37,429,042 N291K possibly damaging Het
Zfp119a G A 17: 55,866,325 R173C probably benign Het
Zmynd15 T C 11: 70,464,182 L335P probably damaging Het
Other mutations in Il17f
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0800:Il17f UTSW 1 20777953 nonsense probably null
R2224:Il17f UTSW 1 20779375 missense probably damaging 0.97
R4074:Il17f UTSW 1 20777763 unclassified probably benign
R5386:Il17f UTSW 1 20777957 missense probably benign 0.00
R6009:Il17f UTSW 1 20779286 splice site probably null
R6416:Il17f UTSW 1 20777907 missense probably benign 0.00
R6751:Il17f UTSW 1 20779489 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CAAGCTATATCTACTGCAGAGCTG -3'
(R):5'- CCTTCAGCATCACTCGAGAC -3'

Sequencing Primer
(F):5'- TTCACACAGAGCTCTGGA -3'
(R):5'- GTTCCCCTCAGAGATCGCTG -3'
Posted On 2015-09-25