Incidental Mutation 'R4594:Olfr1370'
ID344279
Institutional Source Beutler Lab
Gene Symbol Olfr1370
Ensembl Gene ENSMUSG00000042869
Gene Nameolfactory receptor 1370
SynonymsGA_x6K02T2QHY8-12181473-12182423, MOR256-14
MMRRC Submission 041810-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R4594 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location21069334-21074947 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 21072522 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 260 (V260I)
Ref Sequence ENSEMBL: ENSMUSP00000149341 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058168] [ENSMUST00000215357] [ENSMUST00000215806]
Predicted Effect probably benign
Transcript: ENSMUST00000058168
AA Change: V260I

PolyPhen 2 Score 0.298 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000054533
Gene: ENSMUSG00000042869
AA Change: V260I

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srv 24 305 1.8e-8 PFAM
Pfam:7tm_4 31 308 3.6e-54 PFAM
Pfam:7TM_GPCR_Srsx 35 306 1.9e-6 PFAM
Pfam:7tm_1 41 290 2e-29 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213848
Predicted Effect probably benign
Transcript: ENSMUST00000215357
AA Change: V260I

PolyPhen 2 Score 0.298 (Sensitivity: 0.91; Specificity: 0.89)
Predicted Effect probably benign
Transcript: ENSMUST00000215806
AA Change: V260I

PolyPhen 2 Score 0.298 (Sensitivity: 0.91; Specificity: 0.89)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700109H08Rik A G 5: 3,575,754 T64A probably damaging Het
4933427I04Rik A T 4: 123,860,538 T82S possibly damaging Het
Adamts15 A T 9: 30,921,447 I264N probably damaging Het
Alpk1 G A 3: 127,683,554 A285V probably damaging Het
Auh T C 13: 52,912,966 probably benign Het
BC030499 T A 11: 78,291,647 V94D possibly damaging Het
Cacna2d3 A G 14: 28,982,346 F826S probably benign Het
Ccdc54 G T 16: 50,590,017 Y295* probably null Het
Ctnna3 G A 10: 64,586,079 V551I probably benign Het
Diaph3 C T 14: 86,986,037 C347Y probably damaging Het
Dnajb5 A G 4: 42,950,842 probably benign Het
Dscam A T 16: 96,717,996 I847K possibly damaging Het
Fam8a1 T C 13: 46,671,266 F243S probably damaging Het
Fat2 T C 11: 55,284,752 I1712V possibly damaging Het
Fgfr1 T C 8: 25,573,836 V793A probably damaging Het
Got2 T C 8: 95,872,186 E196G probably benign Het
Gsk3b G A 16: 38,170,701 C107Y possibly damaging Het
H2-M5 T C 17: 36,987,805 T250A possibly damaging Het
Il17f T A 1: 20,777,802 T151S probably damaging Het
Ints12 A G 3: 133,108,868 N279D probably benign Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Kynu T A 2: 43,679,890 S395T probably benign Het
Llgl1 C T 11: 60,706,321 T226I probably benign Het
Mael T A 1: 166,235,487 Q132L probably damaging Het
Mcpt1 A T 14: 56,018,652 R49S probably benign Het
Meioc G T 11: 102,674,166 G203C probably damaging Het
Mfsd4b1 A G 10: 40,007,317 S46P probably benign Het
Muc6 G T 7: 141,638,772 T1996N possibly damaging Het
Mx2 C A 16: 97,547,432 Y268* probably null Het
Myom1 A G 17: 71,100,074 D1064G possibly damaging Het
Nek11 A G 9: 105,392,847 probably null Het
Nfe2 A G 15: 103,248,805 L253S probably damaging Het
Nup205 T C 6: 35,196,489 I478T probably benign Het
Nxpe2 T C 9: 48,319,482 D529G probably damaging Het
Oard1 T C 17: 48,415,239 S88P possibly damaging Het
Olfr231 G T 1: 174,117,320 T232N probably damaging Het
Olfr639 T C 7: 104,012,417 D95G probably benign Het
Olfr678 T C 7: 105,069,590 V41A probably benign Het
Olfr732 G A 14: 50,281,683 T190I probably benign Het
Olfr741 A G 14: 50,486,162 R235G probably benign Het
Olfr906 A C 9: 38,488,761 H244P probably damaging Het
Osgin1 C T 8: 119,445,253 T262I possibly damaging Het
Plcb4 A T 2: 136,002,599 M146L probably damaging Het
Prkdc A T 16: 15,767,966 E2456V possibly damaging Het
Ptk2 G A 15: 73,206,196 A1004V probably damaging Het
Rab15 G A 12: 76,800,671 probably benign Het
Rad51ap2 T C 12: 11,457,880 V601A probably benign Het
Rasef T A 4: 73,780,389 I12F possibly damaging Het
Rdh14 T A 12: 10,394,567 N139K probably damaging Het
Rexo2 A T 9: 48,480,417 V46E probably damaging Het
Slmap A T 14: 26,465,617 L68H probably damaging Het
Speer3 C G 5: 13,796,380 A238G possibly damaging Het
Tmem132e T C 11: 82,435,068 I206T possibly damaging Het
Trappc8 A T 18: 20,836,948 V995E probably benign Het
Vmn2r12 A C 5: 109,086,435 I637S probably damaging Het
Vmn2r124 T C 17: 18,073,969 F773L probably damaging Het
Vmn2r99 A T 17: 19,393,662 D548V probably damaging Het
Wdr81 T C 11: 75,445,794 N1590D probably benign Het
Zbtb6 A T 2: 37,429,042 N291K possibly damaging Het
Zfp119a G A 17: 55,866,325 R173C probably benign Het
Zmynd15 T C 11: 70,464,182 L335P probably damaging Het
Other mutations in Olfr1370
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01655:Olfr1370 APN 13 21072905 missense probably damaging 1.00
IGL02658:Olfr1370 APN 13 21072812 missense probably damaging 1.00
R0281:Olfr1370 UTSW 13 21072374 missense probably benign
R1838:Olfr1370 UTSW 13 21072425 nonsense probably null
R1858:Olfr1370 UTSW 13 21072471 missense probably damaging 0.98
R2181:Olfr1370 UTSW 13 21073224 missense probably damaging 1.00
R4502:Olfr1370 UTSW 13 21072746 missense probably damaging 1.00
R4757:Olfr1370 UTSW 13 21072545 missense probably damaging 1.00
R5222:Olfr1370 UTSW 13 21072569 missense probably damaging 1.00
R6245:Olfr1370 UTSW 13 21072690 missense possibly damaging 0.69
R6350:Olfr1370 UTSW 13 21072605 missense probably benign 0.00
R6360:Olfr1370 UTSW 13 21072583 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAAGTTATGTTTGCTCCGCTCC -3'
(R):5'- CCGGTGATGATCAAGATGTCC -3'

Sequencing Primer
(F):5'- GCTCCCTTGTGATACAATGAGAC -3'
(R):5'- ATAGCTATGCTCTCCATTGTAGGGAC -3'
Posted On2015-09-25