Mutagenetix > Incidental Mutations

Incidental Mutation 'R4673:Cux2'

348609

Institutional Source

Beutler Lab

Gene Symbol

Cux2

Ensembl Gene

ENSMUSG00000042589

Gene Name

cut-like homeobox 2

Synonyms

Cutl2, Cux-2, ENSMUSG00000072641, 1700051K22Rik, Cux2

MMRRC Submission

041928-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.367) question?

Stock #

R4673 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

121856366-122050102 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

G to T at 121887476 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Stop codon at position 43 (S43*)

Ref Sequence

ENSEMBL: ENSMUSP00000130302 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000086317] [ENSMUST00000111752] [ENSMUST00000134326] [ENSMUST00000154139] [ENSMUST00000168288]

Predicted Effect

probably null
Transcript: ENSMUST00000086317
AA Change: S43*

SMART Domains

Protein: ENSMUSP00000083497
Gene: ENSMUSG00000042589
AA Change: S43*

Domain	Start	End	E-Value	Type
coiled coil region	133	214	N/A	INTRINSIC
coiled coil region	235	311	N/A	INTRINSIC
low complexity region	373	394	N/A	INTRINSIC
low complexity region	397	408	N/A	INTRINSIC
low complexity region	459	474	N/A	INTRINSIC
CUT	484	569	7.62e-34	SMART
coiled coil region	626	655	N/A	INTRINSIC
low complexity region	688	696	N/A	INTRINSIC
low complexity region	740	757	N/A	INTRINSIC
CUT	829	917	6.52e-42	SMART
low complexity region	965	976	N/A	INTRINSIC
CUT	984	1070	1.12e-40	SMART
HOX	1113	1175	7.54e-13	SMART
low complexity region	1318	1332	N/A	INTRINSIC
low complexity region	1351	1370	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000111752
AA Change: S43*

SMART Domains

Protein: ENSMUSP00000107381
Gene: ENSMUSG00000042589
AA Change: S43*

Domain	Start	End	E-Value	Type
coiled coil region	133	214	N/A	INTRINSIC
coiled coil region	235	311	N/A	INTRINSIC
low complexity region	373	394	N/A	INTRINSIC
low complexity region	397	408	N/A	INTRINSIC
low complexity region	459	474	N/A	INTRINSIC
CUT	484	569	7.62e-34	SMART
coiled coil region	626	655	N/A	INTRINSIC
low complexity region	688	696	N/A	INTRINSIC
low complexity region	740	757	N/A	INTRINSIC
CUT	829	917	6.52e-42	SMART
low complexity region	965	976	N/A	INTRINSIC
CUT	984	1070	1.12e-40	SMART
HOX	1113	1175	7.54e-13	SMART
low complexity region	1318	1332	N/A	INTRINSIC
low complexity region	1351	1370	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000133760

Predicted Effect

probably null
Transcript: ENSMUST00000134326
AA Change: S43*

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000144069

Predicted Effect

probably null
Transcript: ENSMUST00000154139
AA Change: S43*

SMART Domains

Protein: ENSMUSP00000114948
Gene: ENSMUSG00000042589
AA Change: S43*

Domain	Start	End	E-Value	Type
low complexity region	1	27	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000168288
AA Change: S43*

SMART Domains

Protein: ENSMUSP00000130302
Gene: ENSMUSG00000042589
AA Change: S43*

Domain	Start	End	E-Value	Type
coiled coil region	133	214	N/A	INTRINSIC
coiled coil region	235	311	N/A	INTRINSIC
low complexity region	373	394	N/A	INTRINSIC
low complexity region	397	408	N/A	INTRINSIC
low complexity region	459	474	N/A	INTRINSIC
CUT	484	569	7.62e-34	SMART
coiled coil region	626	655	N/A	INTRINSIC
low complexity region	688	696	N/A	INTRINSIC
low complexity region	740	757	N/A	INTRINSIC
CUT	829	917	6.52e-42	SMART
low complexity region	965	976	N/A	INTRINSIC
CUT	984	1070	1.12e-40	SMART
HOX	1113	1175	7.54e-13	SMART
low complexity region	1318	1332	N/A	INTRINSIC
low complexity region	1351	1370	N/A	INTRINSIC

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 95.2%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene is a member of the Cut family of transcription factors that have multiple DNA binding domains and regulate cell proliferation and differentiation. This gene is primarily expressed in nervous tissues where it controls the proliferation of neuronal precursors, and may play a role in organogenesis earlier during embryonic development. Mice lacking the encoded protein exhibit smaller spinal cords with deficits in neural progenitor development as well as in neuroblast and interneuron differentiation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2015]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit various neural defects. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam32	T	C	8: 24,884,455	E507G	probably damaging	Het
Adam39	C	T	8: 40,824,731	T53I	probably benign	Het
Adam4	A	T	12: 81,421,761	S29T	possibly damaging	Het
Adamdec1	C	A	14: 68,577,904	E104*	probably null	Het
Alas1	G	T	9: 106,236,477	P523Q	probably damaging	Het
Aldh3a1	A	G	11: 61,213,494	D69G	probably benign	Het
Arhgap29	T	A	3: 122,014,971	V1266E	probably damaging	Het
Bcdin3d	T	C	15: 99,470,838	D160G	probably damaging	Het
Btaf1	T	A	19: 36,978,372	F569I	probably benign	Het
Cacna1b	A	G	2: 24,631,944	L1718S	probably damaging	Het
Casd1	A	G	6: 4,629,975	Y457C	probably damaging	Het
Creb3	T	C	4: 43,563,192	V97A	probably benign	Het
Fam160a1	A	T	3: 85,730,713	V93D	probably damaging	Het
Fsbp	T	G	4: 11,579,841	N36K	probably benign	Het
Gm11565	A	G	11: 99,915,214	D144G	probably benign	Het
Gm7534	G	A	4: 134,200,347	A365V	probably benign	Het
Gpn3	A	G	5: 122,373,918	Y19C	probably damaging	Het
Gstz1	A	T	12: 87,162,063	T148S	probably benign	Het
Gtf3c5	A	G	2: 28,572,224	I282T	probably benign	Het
Hspa2	T	A	12: 76,405,740	S403T	possibly damaging	Het
Il27	G	A	7: 126,591,079	T121I	possibly damaging	Het
Itpr2	A	G	6: 146,373,173	F837S	probably damaging	Het
Kctd1	T	A	18: 15,063,227		probably benign	Het
Kynu	A	G	2: 43,679,803	T366A	probably damaging	Het
Lama5	G	A	2: 180,199,266	T507I	probably damaging	Het
Myh11	C	T	16: 14,269,241	V124M	probably damaging	Het
Myh14	T	A	7: 44,624,330	H1331L	probably damaging	Het
Myh2	T	A	11: 67,188,477	L957Q	probably damaging	Het
Myh4	T	C	11: 67,246,401	F483L	probably benign	Het
Nbeal1	A	C	1: 60,329,390	K2631N	probably damaging	Het
Ofcc1	G	A	13: 40,015,388	T841I	probably damaging	Het
Ogg1	T	C	6: 113,327,307	C28R	probably damaging	Het
Olfr1449	G	A	19: 12,935,097	A120T	probably damaging	Het
Olfr157	T	C	4: 43,836,430	H20R	probably benign	Het
Olfr181	C	T	16: 58,925,690	V294I	possibly damaging	Het
Olfr49	C	T	14: 54,282,332	A188T	possibly damaging	Het
Olfr855	A	G	9: 19,585,430	K298E	possibly damaging	Het
Parp6	G	C	9: 59,640,110	R460P	probably damaging	Het
Phf14	A	G	6: 11,992,057	H744R	probably damaging	Het
Pibf1	A	G	14: 99,133,351	N263S	possibly damaging	Het
Plcb4	A	G	2: 135,932,271	T158A	possibly damaging	Het
Plce1	T	C	19: 38,749,396	S1615P	possibly damaging	Het
Plxna3	T	G	X: 74,338,948		probably null	Het
Rad54b	T	A	4: 11,609,449	H633Q	probably benign	Het
Rgs22	T	A	15: 36,099,933	Y212F	probably benign	Het
Rnd3	G	A	2: 51,132,541	A163V	probably benign	Het
Rnf10	A	T	5: 115,251,089	V315E	probably damaging	Het
Robo2	C	T	16: 73,904,378		probably null	Het
Rp1l1	T	G	14: 64,031,270	V1435G	probably damaging	Het
Scaf8	T	A	17: 3,197,985	D1194E	probably benign	Het
Sept12	T	C	16: 4,991,943	T198A	probably damaging	Het
Shisa2	A	G	14: 59,630,180	T294A	probably damaging	Het
Spta1	A	G	1: 174,191,062		probably null	Het
Strbp	A	T	2: 37,645,679	S6T	probably damaging	Het
Syf2	A	G	4: 134,934,493	E56G	probably damaging	Het
Thap4	T	C	1: 93,714,866		probably benign	Het
Tnfaip3	T	C	10: 19,011,832		probably benign	Het
Tnxb	A	G	17: 34,672,540	E619G	probably damaging	Het
Tpr	G	A	1: 150,423,567	A1173T	probably benign	Het
Tspan3	G	A	9: 56,136,696	R240W	probably damaging	Het
Ubr4	C	T	4: 139,410,716	S1128L	probably damaging	Het
Ucp1	T	C	8: 83,295,247	V236A	probably damaging	Het
Usp34	TCACCACCACCACCACCACCACCACCAC	TCACCACCACCACCACCACCACCAC	11: 23,364,480		probably benign	Het
Zcchc6	G	T	13: 59,796,845	T658K	probably damaging	Het
Zfp940	T	C	7: 29,845,438	D348G	probably benign	Het

Other mutations in Cux2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00424:Cux2	APN	5	121868538	missense	possibly damaging	0.92
IGL00917:Cux2	APN	5	121869105	missense	probably null	0.05
IGL00979:Cux2	APN	5	121873714	missense	probably damaging	0.98
IGL01069:Cux2	APN	5	121867351	missense	possibly damaging	0.84
IGL01303:Cux2	APN	5	121865928	missense	probably benign	0.03
IGL01583:Cux2	APN	5	121874107	missense	probably damaging	0.98
IGL01762:Cux2	APN	5	121873145	missense	probably damaging	1.00
IGL02508:Cux2	APN	5	121860822	missense	possibly damaging	0.93
R0333:Cux2	UTSW	5	121860608	missense	probably benign	0.04
R0352:Cux2	UTSW	5	121884739	splice site	probably benign
R0443:Cux2	UTSW	5	121887437	missense	possibly damaging	0.66
R1853:Cux2	UTSW	5	121869121	missense	possibly damaging	0.95
R2011:Cux2	UTSW	5	121861326	missense	probably benign	0.21
R2057:Cux2	UTSW	5	121869504	missense	probably benign	0.02
R2165:Cux2	UTSW	5	121887477	missense	possibly damaging	0.78
R3964:Cux2	UTSW	5	121887476	nonsense	probably null
R4182:Cux2	UTSW	5	121868492	missense	probably damaging	1.00
R4579:Cux2	UTSW	5	121860653	missense	probably benign	0.01
R4655:Cux2	UTSW	5	121885934	missense	possibly damaging	0.95
R4697:Cux2	UTSW	5	121873753	missense	probably damaging	1.00
R4927:Cux2	UTSW	5	121877089	missense	probably benign	0.13
R5348:Cux2	UTSW	5	121865978	missense	probably damaging	0.99
R6208:Cux2	UTSW	5	121860822	missense	possibly damaging	0.93
R6500:Cux2	UTSW	5	121864726	missense	probably benign	0.03
R6661:Cux2	UTSW	5	121869297	missense	probably benign	0.04
R6986:Cux2	UTSW	5	121868579	missense	possibly damaging	0.84
R7296:Cux2	UTSW	5	121861256	missense	probably benign	0.25
R7561:Cux2	UTSW	5	121879868	missense	probably benign	0.31
R7702:Cux2	UTSW	5	121868585	missense	possibly damaging	0.70
R7705:Cux2	UTSW	5	121869673	missense	probably benign	0.13
R7791:Cux2	UTSW	5	121867099	missense	probably benign	0.10
R7998:Cux2	UTSW	5	121868585	missense	possibly damaging	0.70
R8081:Cux2	UTSW	5	121869456	missense	probably benign	0.13
R8096:Cux2	UTSW	5	121869097	missense	possibly damaging	0.70
R8191:Cux2	UTSW	5	121874154	missense	probably benign	0.31
X0027:Cux2	UTSW	5	121884751	missense	probably benign	0.13
Z1176:Cux2	UTSW	5	121873813	nonsense	probably null
Z1176:Cux2	UTSW	5	121885934	missense	probably benign	0.02
Z1177:Cux2	UTSW	5	121873680	missense	probably damaging	1.00
Z1177:Cux2	UTSW	5	121877129	missense	probably benign	0.13

Predicted Primers

PCR Primer
(F):5'- CTGACATCTAGGTTTGTCCCCAAC -3'
(R):5'- CTGGGATTAAAGGCATGCGC -3'

Sequencing Primer
(F):5'- CATCCCGCAGTGGTGTCATTG -3'
(R):5'- GCCAGGCTCACACACACAG -3'

Posted On

2015-10-08