Incidental Mutation 'R4686:Stk25'
ID353648
Institutional Source Beutler Lab
Gene Symbol Stk25
Ensembl Gene ENSMUSG00000026277
Gene Nameserine/threonine kinase 25 (yeast)
Synonyms1500019J11Rik, SOK-1, Ste20-like, Ysk1
MMRRC Submission 041937-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4686 (G1)
Quality Score123
Status Validated
Chromosome1
Chromosomal Location93619751-93658659 bp(-) (GRCm38)
Type of Mutationunclassified (1444 bp from exon)
DNA Base Change (assembly) A to G at 93623420 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000112725 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027498] [ENSMUST00000120301] [ENSMUST00000133769] [ENSMUST00000186287]
PDB Structure
Crystal strucure of the DH domain of FARP2 [X-RAY DIFFRACTION]
Crystal strucure of the DH-PH-PH domain of FARP2 [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000027498
AA Change: V406A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000027498
Gene: ENSMUSG00000026277
AA Change: V406A

DomainStartEndE-ValueType
S_TKc 20 270 2.92e-98 SMART
low complexity region 292 314 N/A INTRINSIC
PDB:3W8H|B 355 426 8e-43 PDB
Predicted Effect probably null
Transcript: ENSMUST00000120301
SMART Domains Protein: ENSMUSP00000112725
Gene: ENSMUSG00000034066

DomainStartEndE-ValueType
B41 40 234 1.48e-66 SMART
FERM_C 238 328 3.29e-35 SMART
FA 332 378 1.13e-15 SMART
low complexity region 409 421 N/A INTRINSIC
low complexity region 440 459 N/A INTRINSIC
low complexity region 462 473 N/A INTRINSIC
low complexity region 478 492 N/A INTRINSIC
RhoGEF 542 728 1.57e-56 SMART
PH 759 857 1.45e-19 SMART
low complexity region 879 890 N/A INTRINSIC
PH 931 1029 2.62e-17 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125778
Predicted Effect probably benign
Transcript: ENSMUST00000133769
SMART Domains Protein: ENSMUSP00000117765
Gene: ENSMUSG00000026277

DomainStartEndE-ValueType
Pfam:Pkinase 20 233 1.7e-63 PFAM
Pfam:Pkinase_Tyr 20 233 2.1e-47 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151068
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154008
Predicted Effect probably benign
Transcript: ENSMUST00000186287
SMART Domains Protein: ENSMUSP00000140396
Gene: ENSMUSG00000026277

DomainStartEndE-ValueType
STYKc 20 107 1.9e-4 SMART
Meta Mutation Damage Score 0.0788 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 97% (68/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the germinal centre kinase III (GCK III) subfamily of the sterile 20 superfamily of kinases. The encoded enzyme plays a role in serine-threonine liver kinase B1 (LKB1) signaling pathway to regulate neuronal polarization and morphology of the Golgi apparatus. The protein is translocated from the Golgi apparatus to the nucleus in response to chemical anoxia and plays a role in regulation of cell death. A pseudogene associated with this gene is located on chromosome 18. Multiple alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, Dec 2012]
PHENOTYPE: Germ line null mutants display normal cortical layers and neuronal migration. Acute loss of expression results in impaired neuronal migration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamtsl2 A G 2: 27,093,825 N411S probably damaging Het
Adnp A C 2: 168,182,389 C995W possibly damaging Het
Akap6 CA C 12: 52,887,623 probably null Het
Ano2 T G 6: 125,790,291 I228M probably benign Het
Arhgap21 T C 2: 20,863,222 D830G probably damaging Het
Atp13a2 G A 4: 141,003,276 probably null Het
Ccdc175 C T 12: 72,112,278 S629N probably damaging Het
Cdhr4 T C 9: 107,995,684 W311R probably benign Het
Chaf1b A G 16: 93,884,584 H30R probably benign Het
Clnk G A 5: 38,741,837 probably benign Het
Copb1 A G 7: 114,221,736 S773P possibly damaging Het
Cse1l A G 2: 166,932,160 D198G probably damaging Het
Ears2 A G 7: 122,048,204 S286P probably damaging Het
Efcab7 A G 4: 99,878,116 E114G probably benign Het
Fanca G C 8: 123,268,934 probably benign Het
Flt3 A G 5: 147,377,048 L64P probably damaging Het
Gabrb1 A G 5: 71,700,022 T3A possibly damaging Het
Gm10384 T C 15: 36,871,653 noncoding transcript Het
Gm5117 G A 8: 31,739,256 noncoding transcript Het
Gpr141 T A 13: 19,751,781 I275F probably benign Het
Greb1l A T 18: 10,522,112 E736V probably damaging Het
Hc T C 2: 35,039,248 E279G possibly damaging Het
Hivep1 C T 13: 42,155,850 T522M probably benign Het
Hspa12a T A 19: 58,799,749 E547V possibly damaging Het
Il10ra A G 9: 45,269,059 L5S probably damaging Het
Iqcf6 G T 9: 106,627,344 W69L probably damaging Het
Iqgap2 T C 13: 95,721,609 N379S probably damaging Het
Itpr2 A G 6: 146,229,775 I1977T probably damaging Het
Kcnq1 A T 7: 143,107,729 Y124F probably benign Het
Lamp5 C T 2: 136,059,003 T41M probably damaging Het
Lgr5 A G 10: 115,458,743 probably benign Het
Mlec A G 5: 115,150,296 I167T possibly damaging Het
Myf6 A G 10: 107,493,828 V198A probably benign Het
Nceh1 C T 3: 27,241,669 R360C probably damaging Het
Nos2 C A 11: 78,928,630 T56N possibly damaging Het
Npw T G 17: 24,657,412 H175P probably benign Het
Nrxn3 A T 12: 89,510,651 I899F probably damaging Het
Ociad1 A G 5: 73,306,735 T179A possibly damaging Het
Olfr378 A G 11: 73,425,438 S182P probably benign Het
Olfr547 A G 7: 102,535,149 Y134C probably damaging Het
Olfr912 T A 9: 38,582,031 F251L probably damaging Het
Pacsin2 T C 15: 83,381,775 N74D probably benign Het
Pcdh7 A G 5: 58,129,169 I1196V probably benign Het
Pdxk A T 10: 78,447,003 probably null Het
Phb2 G A 6: 124,713,142 probably null Het
Pus7l T A 15: 94,540,211 N251I probably damaging Het
Rgs7bp T A 13: 104,964,089 N226I probably damaging Het
Runx2 T A 17: 44,639,685 D327V probably damaging Het
Srp68 A T 11: 116,265,401 C172S probably damaging Het
Tbrg4 C T 11: 6,618,468 R437Q probably benign Het
Tedc2 C T 17: 24,217,888 probably null Het
Teddm1a T A 1: 153,892,450 I220N probably damaging Het
Thoc1 G T 18: 9,970,312 E221* probably null Het
Tmem132d G T 5: 127,792,610 D553E possibly damaging Het
Topors A T 4: 40,261,694 V530D probably benign Het
Tpx2 T C 2: 152,889,183 V515A possibly damaging Het
Trim24 A G 6: 37,908,305 H191R probably damaging Het
Ttn G A 2: 76,737,570 R27660W probably damaging Het
Vmn1r203 T C 13: 22,524,358 L103P probably damaging Het
Vmn1r233 C T 17: 20,994,106 S194N probably benign Het
Vmn2r108 T C 17: 20,471,374 K296E probably damaging Het
Vmn2r88 G A 14: 51,413,339 E170K probably benign Het
Zfp740 C T 15: 102,208,749 probably benign Het
Zmym5 A G 14: 56,812,161 probably benign Het
Other mutations in Stk25
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01291:Stk25 APN 1 93623423 unclassified probably null
IGL02952:Stk25 APN 1 93626076 missense probably damaging 1.00
IGL03144:Stk25 APN 1 93629136 missense probably damaging 1.00
ANU05:Stk25 UTSW 1 93623423 unclassified probably null
IGL02980:Stk25 UTSW 1 93627668 missense probably damaging 1.00
PIT4531001:Stk25 UTSW 1 93624624 missense probably benign
R0240:Stk25 UTSW 1 93627060 missense probably damaging 1.00
R0240:Stk25 UTSW 1 93627060 missense probably damaging 1.00
R0555:Stk25 UTSW 1 93624591 missense probably benign 0.00
R1178:Stk25 UTSW 1 93623389 unclassified probably benign
R1406:Stk25 UTSW 1 93625153 unclassified probably benign
R1493:Stk25 UTSW 1 93625600 missense probably benign 0.04
R2875:Stk25 UTSW 1 93629251 missense possibly damaging 0.91
R4657:Stk25 UTSW 1 93625656 unclassified probably benign
R4668:Stk25 UTSW 1 93625483 missense probably damaging 1.00
R5089:Stk25 UTSW 1 93624608 missense probably benign 0.05
R5493:Stk25 UTSW 1 93635309 missense probably benign
R6013:Stk25 UTSW 1 93625459 critical splice donor site probably null
X0063:Stk25 UTSW 1 93625961 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCCGAAAATGAGGGTCCAAC -3'
(R):5'- GTAGGTCTTCCAAGTCATCCAGG -3'

Sequencing Primer
(F):5'- GAGGGTCCAACCTTCATGCATAATTC -3'
(R):5'- GTCTTCCAAGTCATCCAGGTAAGATG -3'
Posted On2015-10-21