Incidental Mutation 'R4755:Olfr653'
ID357919
Institutional Source Beutler Lab
Gene Symbol Olfr653
Ensembl Gene ENSMUSG00000073926
Gene Nameolfactory receptor 653
SynonymsMOR33-1, GA_x6K02T2PBJ9-7206970-7207923
MMRRC Submission 042033-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.086) question?
Stock #R4755 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location104577314-104584117 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 104580061 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 138 (Y138*)
Ref Sequence ENSEMBL: ENSMUSP00000149192 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098174] [ENSMUST00000215585] [ENSMUST00000217466]
Predicted Effect probably null
Transcript: ENSMUST00000098174
AA Change: Y138*
SMART Domains Protein: ENSMUSP00000095776
Gene: ENSMUSG00000073926
AA Change: Y138*

DomainStartEndE-ValueType
Pfam:7tm_4 37 316 2.2e-111 PFAM
Pfam:7TM_GPCR_Srsx 41 179 4.6e-10 PFAM
Pfam:7tm_1 47 298 5.9e-22 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000215585
AA Change: Y138*
Predicted Effect probably null
Transcript: ENSMUST00000217466
AA Change: Y138*
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 96% (112/117)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 113 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930449A18Rik T A 3: 59,825,859 noncoding transcript Het
Accs T C 2: 93,841,337 E236G probably damaging Het
Agrn C T 4: 156,173,522 probably benign Het
Ahi1 A G 10: 21,055,047 I929V possibly damaging Het
Akap5 C A 12: 76,327,807 C4* probably null Het
Amotl2 A T 9: 102,720,480 H146L probably damaging Het
Ank1 A G 8: 23,104,974 N666S probably damaging Het
Atp10d A T 5: 72,246,166 T373S probably benign Het
Bpifb9b T A 2: 154,319,694 M582K probably benign Het
Brca2 T A 5: 150,559,987 probably null Het
C130079G13Rik C T 3: 59,936,314 A143V probably benign Het
C330021F23Rik A T 8: 3,583,922 S8C probably damaging Het
Ccdc149 A G 5: 52,404,151 V229A probably damaging Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Cdk5rap2 A G 4: 70,238,425 S1617P probably damaging Het
Cenpk A T 13: 104,230,871 M37L probably benign Het
Cenpk A T 13: 104,249,512 H305L probably benign Het
Ces5a C A 8: 93,535,677 A11S probably benign Het
Cfap65 T C 1: 74,928,361 E186G probably damaging Het
Cfh T A 1: 140,088,808 I593F probably damaging Het
Clstn2 C T 9: 97,445,673 V961I probably benign Het
Cog5 T A 12: 31,869,406 probably null Het
Col4a4 T C 1: 82,541,174 D100G unknown Het
Cyp3a41a T C 5: 145,715,506 D61G probably damaging Het
Dnah10 A G 5: 124,747,745 N655S probably benign Het
Dnaic1 C G 4: 41,610,269 T295R probably damaging Het
Dnajc6 C T 4: 101,550,799 A44V probably damaging Het
Eif4enif1 A T 11: 3,244,016 D960V probably damaging Het
Fam167b C T 4: 129,578,342 G12R probably damaging Het
Fam20b A T 1: 156,687,496 Y266* probably null Het
Fer1l6 T A 15: 58,640,211 V1509D probably benign Het
Fhad1 A T 4: 141,928,483 I105N probably damaging Het
Fmo2 T C 1: 162,888,805 D71G probably damaging Het
Folr2 T C 7: 101,843,799 T6A possibly damaging Het
Fry A C 5: 150,398,254 E1018A probably damaging Het
Gas2l2 A G 11: 83,429,367 I21T probably damaging Het
Gfra1 T C 19: 58,453,244 Y85C probably damaging Het
Gm9117 T C 3: 93,938,786 probably null Het
Gpld1 A T 13: 24,979,688 Y43F probably benign Het
Gpld1 T A 13: 24,979,692 Y44* probably null Het
Grid2 A G 6: 63,908,988 T123A probably benign Het
Grina T C 15: 76,249,242 L305P probably damaging Het
Gucy1a1 G A 3: 82,094,795 A659V probably benign Het
H2-T10 T A 17: 36,118,945 K319* probably null Het
Hey2 A T 10: 30,834,304 V151E probably benign Het
Ighv1-69 G A 12: 115,623,558 T13I probably benign Het
Il1rap C A 16: 26,722,782 A591E probably benign Het
Ildr1 T C 16: 36,722,021 L261P probably benign Het
Jak1 A G 4: 101,174,157 Y463H probably damaging Het
Lrp1b T C 2: 41,269,273 I1666V probably benign Het
Lrp1b T A 2: 41,471,016 T592S probably benign Het
Lrrc36 A G 8: 105,452,144 T445A possibly damaging Het
Ly9 G A 1: 171,607,238 S29F probably damaging Het
Mapk7 A C 11: 61,490,843 C32W probably damaging Het
March10 C T 11: 105,364,476 probably benign Het
Mier2 A T 10: 79,549,197 M119K probably damaging Het
Mpv17 A T 5: 31,145,982 C59* probably null Het
Mrpl27 G A 11: 94,653,833 probably benign Het
Myo18b G A 5: 112,874,474 Q351* probably null Het
Myo1a A G 10: 127,715,688 I704M probably damaging Het
Nadsyn1 A G 7: 143,806,913 C373R probably damaging Het
Nckipsd C A 9: 108,814,739 A513E probably benign Het
Neb T C 2: 52,220,209 D209G probably damaging Het
Nkapl T A 13: 21,468,287 Q52L unknown Het
Nptx2 G A 5: 144,546,440 S126N probably benign Het
Olfr13 G A 6: 43,174,043 S19N probably benign Het
Olfr829 A T 9: 18,857,180 H185L probably benign Het
Olfr917 A G 9: 38,665,832 V4A probably benign Het
Pclo A T 5: 14,714,348 R4278S unknown Het
Pcnx T G 12: 81,950,294 L988R probably damaging Het
Prl2c5 C A 13: 13,189,385 N75K probably benign Het
Prpf19 T G 19: 10,897,790 probably benign Het
Ralgapa1 A G 12: 55,712,748 S997P probably damaging Het
Rangap1 T C 15: 81,712,917 T226A probably benign Het
Rimklb G A 6: 122,456,406 L262F probably damaging Het
Rnf169 A G 7: 99,925,723 M555T probably benign Het
Rp1l1 A T 14: 64,030,070 D1035V probably benign Het
Scd2 T A 19: 44,301,352 L262Q probably damaging Het
Scgb2b12 T A 7: 32,325,531 M84L probably benign Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Sipa1l1 G A 12: 82,372,386 V613I possibly damaging Het
Slc25a23 T A 17: 57,052,794 D67V possibly damaging Het
Slc25a39 C T 11: 102,406,666 probably benign Het
Slc4a10 T A 2: 62,296,988 F895Y probably damaging Het
Slc5a4a A C 10: 76,186,564 K578Q probably benign Het
Slc6a13 G A 6: 121,325,049 G197S probably damaging Het
Smarca2 A T 19: 26,654,483 E566V possibly damaging Het
Sorbs3 A T 14: 70,184,099 N594K probably benign Het
Spata22 A T 11: 73,345,756 D296V probably damaging Het
Sphk2 G A 7: 45,713,634 A11V possibly damaging Het
Spp1 A T 5: 104,435,215 probably benign Het
Strn3 T A 12: 51,610,216 I760L possibly damaging Het
Syk A T 13: 52,641,986 Y539F probably benign Het
Thsd7b T A 1: 130,210,264 Y1560N probably benign Het
Tmod2 C A 9: 75,597,212 E42* probably null Het
Tom1l1 T C 11: 90,685,116 E30G probably damaging Het
Trav10 G A 14: 53,506,061 A40T probably benign Het
Trav14-2 G A 14: 53,640,780 probably benign Het
Tril T A 6: 53,818,464 E591V probably damaging Het
Trp53bp1 T A 2: 121,228,606 R179* probably null Het
Tspoap1 A T 11: 87,771,663 D562V possibly damaging Het
Usp44 A T 10: 93,846,906 H406L probably damaging Het
Vangl1 A G 3: 102,158,292 I509T probably benign Het
Vax2 T G 6: 83,711,397 L34W probably damaging Het
Vmn1r55 A T 7: 5,147,026 C133S probably damaging Het
Vmn2r8 T A 5: 108,801,700 D427V probably benign Het
Vwde A G 6: 13,205,852 I232T possibly damaging Het
Wnk1 C A 6: 119,963,470 A769S probably damaging Het
Xpo4 A C 14: 57,618,181 S264A probably benign Het
Zfp330 A T 8: 82,769,386 C75* probably null Het
Zfp526 T A 7: 25,225,639 L441Q probably benign Het
Zfp607b T G 7: 27,703,505 L462R probably damaging Het
Zfp719 T A 7: 43,590,793 F602I probably damaging Het
Other mutations in Olfr653
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01588:Olfr653 APN 7 104579943 missense probably damaging 1.00
I2288:Olfr653 UTSW 7 104580386 missense probably damaging 1.00
PIT4131001:Olfr653 UTSW 7 104580030 missense probably damaging 0.99
R0325:Olfr653 UTSW 7 104580360 missense probably damaging 1.00
R1579:Olfr653 UTSW 7 104580061 nonsense probably null
R1599:Olfr653 UTSW 7 104579648 start codon destroyed probably null
R1956:Olfr653 UTSW 7 104579909 missense probably damaging 1.00
R2134:Olfr653 UTSW 7 104579641 start gained probably benign
R2418:Olfr653 UTSW 7 104579934 missense probably benign 0.00
R2483:Olfr653 UTSW 7 104579942 missense probably damaging 1.00
R3623:Olfr653 UTSW 7 104579942 missense probably damaging 1.00
R4049:Olfr653 UTSW 7 104580368 missense probably benign
R4757:Olfr653 UTSW 7 104580197 missense possibly damaging 0.95
R4828:Olfr653 UTSW 7 104579973 missense possibly damaging 0.62
R4842:Olfr653 UTSW 7 104580215 missense probably benign 0.45
R5496:Olfr653 UTSW 7 104580494 missense probably damaging 1.00
R6830:Olfr653 UTSW 7 104580240 missense probably damaging 1.00
R7320:Olfr653 UTSW 7 104580438 nonsense probably null
R7590:Olfr653 UTSW 7 104579942 missense probably damaging 1.00
RF020:Olfr653 UTSW 7 104580290 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACATTGCCTAAAATGCTGGC -3'
(R):5'- CCATGCCAGTGACTGAAAGTG -3'

Sequencing Primer
(F):5'- AATGCTGGCAATATTCTGGCTCAG -3'
(R):5'- AGGCTTGATGCTGGCAC -3'
Posted On2015-11-11