Incidental Mutation 'R4785:Fbn1'
ID366918
Institutional Source Beutler Lab
Gene Symbol Fbn1
Ensembl Gene ENSMUSG00000027204
Gene Namefibrillin 1
SynonymsFib-1
MMRRC Submission 042417-MU
Accession Numbers

Genbank: NM_007993; MGI: 95489

Is this an essential gene? Probably essential (E-score: 0.757) question?
Stock #R4785 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location125300594-125507993 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 125324919 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 2026 (C2026S)
Ref Sequence ENSEMBL: ENSMUSP00000099524 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028633] [ENSMUST00000103234]
Predicted Effect probably damaging
Transcript: ENSMUST00000028633
AA Change: C2026S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000028633
Gene: ENSMUSG00000027204
AA Change: C2026S

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 38 49 N/A INTRINSIC
EGF 118 146 8.52e0 SMART
EGF 149 178 5.4e-2 SMART
Pfam:TB 193 235 6.9e-17 PFAM
EGF_CA 246 287 3.56e-11 SMART
EGF_CA 288 329 9.39e-11 SMART
Pfam:TB 343 388 2.3e-17 PFAM
low complexity region 394 445 N/A INTRINSIC
EGF 454 491 8.57e-5 SMART
EGF_CA 492 531 9.39e-11 SMART
EGF_CA 532 573 2.38e-12 SMART
EGF_CA 574 614 5.48e-12 SMART
EGF_CA 615 655 5.39e-11 SMART
Pfam:TB 670 712 1.4e-17 PFAM
EGF_CA 725 766 1.53e-10 SMART
EGF_CA 767 808 2.42e-13 SMART
EGF_CA 809 848 2.44e-9 SMART
Pfam:TB 862 902 2.1e-14 PFAM
EGF_CA 912 953 3.32e-11 SMART
Pfam:TB 967 1009 3.9e-17 PFAM
EGF_CA 1030 1071 5.11e-12 SMART
EGF_CA 1072 1114 5.39e-11 SMART
EGF_CA 1115 1156 1.55e-11 SMART
EGF_CA 1157 1198 5.48e-12 SMART
EGF_CA 1199 1239 5.61e-9 SMART
EGF_CA 1240 1281 1.22e-9 SMART
EGF_CA 1282 1323 2.62e-9 SMART
EGF_CA 1324 1364 3.27e-10 SMART
EGF_CA 1365 1405 4.7e-11 SMART
EGF_CA 1406 1447 1.91e-11 SMART
EGF_CA 1448 1488 1.98e-9 SMART
EGF_CA 1489 1529 2.13e-9 SMART
Pfam:TB 1549 1590 3.5e-18 PFAM
EGF_CA 1608 1649 2.19e-11 SMART
EGF_CA 1650 1690 3.97e-9 SMART
Pfam:TB 1706 1749 9.7e-18 PFAM
EGF_CA 1768 1809 5.11e-12 SMART
EGF_CA 1810 1850 1.1e-11 SMART
EGF_CA 1851 1892 5.69e-10 SMART
EGF_CA 1893 1931 6.1e-10 SMART
EGF_CA 1932 1974 2.11e-13 SMART
EGF_CA 1975 2014 7.23e-12 SMART
EGF_CA 2015 2056 3.15e-12 SMART
Pfam:TB 2070 2112 3.7e-17 PFAM
EGF_CA 2129 2167 1.24e-10 SMART
EGF_CA 2168 2207 3.81e-11 SMART
EGF_CA 2208 2248 3.81e-11 SMART
EGF 2252 2292 5.24e0 SMART
EGF_CA 2293 2334 9.91e-10 SMART
Pfam:TB 2348 2391 8.5e-18 PFAM
EGF_CA 2404 2445 1.26e-11 SMART
EGF_CA 2446 2486 1.06e-9 SMART
EGF_CA 2487 2525 3.1e-11 SMART
EGF_CA 2526 2568 1.48e-8 SMART
EGF_CA 2569 2608 1.14e-9 SMART
EGF_CA 2609 2649 3.97e-9 SMART
EGF_CA 2650 2689 1.98e-9 SMART
low complexity region 2691 2698 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000103234
AA Change: C2026S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000099524
Gene: ENSMUSG00000027204
AA Change: C2026S

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 38 49 N/A INTRINSIC
EGF 118 146 8.52e0 SMART
EGF 149 178 5.4e-2 SMART
Pfam:TB 194 232 3.5e-10 PFAM
EGF_CA 246 287 3.56e-11 SMART
EGF_CA 288 329 9.39e-11 SMART
Pfam:TB 344 388 6.8e-15 PFAM
low complexity region 394 445 N/A INTRINSIC
EGF 454 491 8.57e-5 SMART
EGF_CA 492 531 9.39e-11 SMART
EGF_CA 532 573 2.38e-12 SMART
EGF_CA 574 614 5.48e-12 SMART
EGF_CA 615 655 5.39e-11 SMART
Pfam:TB 671 712 8.3e-16 PFAM
EGF_CA 725 766 1.53e-10 SMART
EGF_CA 767 808 2.42e-13 SMART
EGF_CA 809 848 2.44e-9 SMART
Pfam:TB 863 898 3.1e-8 PFAM
EGF_CA 912 953 3.32e-11 SMART
Pfam:TB 968 1009 1.5e-15 PFAM
EGF_CA 1030 1071 5.11e-12 SMART
EGF_CA 1072 1114 5.39e-11 SMART
EGF_CA 1115 1156 1.55e-11 SMART
EGF_CA 1157 1198 5.48e-12 SMART
EGF_CA 1199 1239 5.61e-9 SMART
EGF_CA 1240 1281 1.22e-9 SMART
EGF_CA 1282 1323 2.62e-9 SMART
EGF_CA 1324 1364 3.27e-10 SMART
EGF_CA 1365 1405 4.7e-11 SMART
EGF_CA 1406 1447 1.91e-11 SMART
EGF_CA 1448 1488 1.98e-9 SMART
EGF_CA 1489 1529 2.13e-9 SMART
Pfam:TB 1550 1590 5.3e-17 PFAM
EGF_CA 1608 1649 2.19e-11 SMART
EGF_CA 1650 1690 3.97e-9 SMART
Pfam:TB 1707 1749 1.6e-16 PFAM
EGF_CA 1768 1809 5.11e-12 SMART
EGF_CA 1810 1850 1.1e-11 SMART
EGF_CA 1851 1892 5.69e-10 SMART
EGF_CA 1893 1931 6.1e-10 SMART
EGF_CA 1932 1974 2.11e-13 SMART
EGF_CA 1975 2014 7.23e-12 SMART
EGF_CA 2015 2056 3.15e-12 SMART
Pfam:TB 2071 2112 1.9e-15 PFAM
EGF_CA 2129 2167 1.24e-10 SMART
EGF_CA 2168 2207 3.81e-11 SMART
EGF_CA 2208 2248 3.81e-11 SMART
EGF 2252 2292 5.24e0 SMART
EGF_CA 2293 2334 9.91e-10 SMART
Pfam:TB 2349 2391 5.8e-15 PFAM
EGF_CA 2404 2445 1.26e-11 SMART
EGF_CA 2446 2486 1.06e-9 SMART
EGF_CA 2487 2525 3.1e-11 SMART
EGF_CA 2526 2568 1.48e-8 SMART
EGF_CA 2569 2608 1.14e-9 SMART
EGF_CA 2609 2649 3.97e-9 SMART
EGF_CA 2650 2689 1.98e-9 SMART
low complexity region 2691 2698 N/A INTRINSIC
Meta Mutation Damage Score 0.574 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype Strain: 1934905; 4880665
Lethality: D7-D10
FUNCTION: This gene encodes a member of the fibrillin family of proteins. The encoded preproprotein is proteolytically processed to generate two proteins including the extracellular matrix component fibrillin-1 and the protein hormone asprosin. Fibrillin-1 is an extracellular matrix glycoprotein that serves as a structural component of calcium-binding microfibrils. Asprosin, secreted by white adipose tissue, has been shown to regulate glucose homeostasis. Homozygous knockout mice for this gene exhibit impaired aortic development and early postnatal death, which was attributed to a deficiency in the fibrillin-1 protein. Mice with a hypomorphic allele of this gene exhibit impaired glucose homeostasis, likely due to a reduction in serum asprosin levels. [provided by RefSeq, Apr 2016]
PHENOTYPE: Lethality among homozygotes for spontaneous and targeted mutations ranges from embryonic death to death around 4 months. Abnormalities include vascular defects, excess bone growth, connective tissue hyperplasia, and lung emphysema. Mice heterozygous for a knock-in allele exhibit scleroderma. [provided by MGI curators]
Allele List at MGI

All alleles(10) : Targeted(9) Spontaneous(1)

Other mutations in this stock
Total: 145 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921517D22Rik T C 13: 59,691,592 D13G probably benign Het
4930442H23Rik C T 10: 81,183,144 probably benign Het
5330417C22Rik A T 3: 108,458,227 probably benign Het
Adamts13 T A 2: 26,983,042 S341T probably damaging Het
Adamts2 A G 11: 50,792,722 I944V probably benign Het
Adcy3 A G 12: 4,206,542 T783A probably benign Het
Ago3 A T 4: 126,368,503 M418K probably benign Het
Alpk1 G T 3: 127,687,592 N175K possibly damaging Het
Als2 A G 1: 59,215,313 V295A probably benign Het
Anapc13 T C 9: 102,629,821 I11T probably benign Het
Ankrd12 T A 17: 65,982,999 N1813I probably damaging Het
Anks1b A T 10: 90,914,750 I176F probably null Het
Ap3d1 TTCTCTCTCTCTCTCTCT TTCTCTCTCTCTCTCT 10: 80,712,778 probably null Het
Arhgap32 A G 9: 32,129,653 D67G probably damaging Het
Arhgap32 T C 9: 32,260,780 C1619R probably damaging Het
Atp1a4 A T 1: 172,254,110 Y158* probably null Het
Atp8b5 A T 4: 43,356,980 D576V probably damaging Het
Atrnl1 A G 19: 57,629,158 I122V probably damaging Het
B430203G13Rik A T 12: 17,924,519 noncoding transcript Het
Baz1b T G 5: 135,217,413 L572R possibly damaging Het
Ccnd2 T C 6: 127,148,798 T92A possibly damaging Het
Ccndbp1 A T 2: 121,008,522 T5S probably benign Het
Ccr2 G A 9: 124,106,372 V230I probably benign Het
Cct4 T A 11: 23,002,866 V514E probably damaging Het
Cep152 A G 2: 125,586,329 probably null Het
Cflar C T 1: 58,752,567 T343M probably benign Het
Chrm5 A C 2: 112,479,585 N395K probably benign Het
Chrna10 G A 7: 102,113,219 P255S possibly damaging Het
Chrna6 T A 8: 27,407,106 I248F probably damaging Het
Clip1 T C 5: 123,579,293 D1387G probably damaging Het
Clstn3 T C 6: 124,437,372 probably null Het
Cntnap5a C T 1: 116,101,565 R250W probably benign Het
Col12a1 C A 9: 79,678,494 V1228F possibly damaging Het
Cxcr5 T C 9: 44,513,341 T340A probably benign Het
Cyp2a4 G A 7: 26,312,875 R361K probably damaging Het
Dnah1 T A 14: 31,263,479 K3818N probably damaging Het
Dnah3 T A 7: 119,967,824 K2393M probably benign Het
Dpy19l1 A T 9: 24,424,823 L529Q probably damaging Het
Eif4g2 C T 7: 111,076,796 R399H probably damaging Het
Fam160a1 G T 3: 85,688,570 T115K probably damaging Het
Fam76a A T 4: 132,902,117 probably null Het
Fam76a A G 4: 132,916,190 Y78H probably damaging Het
Fbxo4 T C 15: 3,969,041 T312A probably benign Het
Fbxw26 A G 9: 109,724,800 V257A possibly damaging Het
Flnb A T 14: 7,905,701 E1150D probably benign Het
Fndc3c1 A T X: 106,437,702 S661R possibly damaging Het
Gba2 A C 4: 43,568,315 L684R probably damaging Het
Gbf1 G T 19: 46,268,395 C812F possibly damaging Het
Glt8d2 A T 10: 82,660,749 D158E probably damaging Het
Golga2 T A 2: 32,297,156 N89K probably damaging Het
Got1 A G 19: 43,502,937 I358T possibly damaging Het
Gpx6 C T 13: 21,312,264 Q3* probably null Het
Grin1 T A 2: 25,292,381 H956L possibly damaging Het
Grin2d A G 7: 45,856,781 V562A probably damaging Het
Grm6 A G 11: 50,857,277 I405V probably benign Het
Hcar2 C G 5: 123,864,450 G330A probably benign Het
Hcfc1 T C X: 73,965,946 K20E probably damaging Het
Iars T A 13: 49,724,663 Y888N probably damaging Het
Ifi206 A T 1: 173,480,866 H521Q probably benign Het
Impg1 A G 9: 80,398,450 S112P probably benign Het
Incenp C A 19: 9,877,690 R619M unknown Het
Incenp T A 19: 9,877,691 R619W unknown Het
Kat2b A G 17: 53,653,203 E513G possibly damaging Het
Kbtbd12 G T 6: 88,618,021 L276I probably damaging Het
Kctd9 T A 14: 67,734,164 D229E probably damaging Het
Kdm1b C T 13: 47,063,077 R308W probably damaging Het
Kif2b G A 11: 91,576,428 P343L probably benign Het
Kntc1 T G 5: 123,816,762 M2081R possibly damaging Het
Lamc1 T C 1: 153,231,740 N1231S probably damaging Het
Lclat1 T A 17: 73,240,070 Y327* probably null Het
Lgals3bp G A 11: 118,393,514 T413I probably damaging Het
Lin54 A G 5: 100,459,738 I250T probably damaging Het
Lrp1 T C 10: 127,558,133 N2621S probably benign Het
Lrrtm3 T A 10: 64,088,002 H462L probably benign Het
Lysmd1 A G 3: 95,134,986 Y57C probably damaging Het
Mccc1 C A 3: 35,975,873 M429I probably damaging Het
Metrnl A G 11: 121,707,924 E40G probably benign Het
Mios T A 6: 8,222,464 M466K probably benign Het
Mrgpra1 A G 7: 47,335,470 S154P probably damaging Het
Mrpl24 T C 3: 87,922,050 probably null Het
Myo1f A G 17: 33,598,191 N736S possibly damaging Het
Myo1h A G 5: 114,360,599 I919V possibly damaging Het
Nampt T C 12: 32,848,714 L443P possibly damaging Het
Ndufaf2 C G 13: 108,052,780 A145P probably damaging Het
Nek10 A T 14: 14,855,714 T403S probably benign Het
Nme8 C A 13: 19,657,930 V219L probably damaging Het
Nov A T 15: 54,752,207 probably null Het
Nps T A 7: 135,268,788 L13Q probably damaging Het
Nutm1 G A 2: 112,248,936 A878V probably benign Het
Ogdh T C 11: 6,349,875 F794L probably damaging Het
Olfr1305 A T 2: 111,873,050 D268E possibly damaging Het
Olfr1441 A T 19: 12,422,977 I223F probably damaging Het
Olfr292 T C 7: 86,694,528 L24P probably damaging Het
Olfr305 C A 7: 86,363,735 G201C probably damaging Het
Olfr721-ps1 A C 14: 14,407,729 Y167S possibly damaging Het
Olfr998 A G 2: 85,590,938 T133A probably benign Het
Pik3cg T C 12: 32,205,199 E263G probably damaging Het
Pikfyve A G 1: 65,267,846 T1798A probably benign Het
Poldip3 T C 15: 83,131,501 Y305C probably damaging Het
Pqlc2 G T 4: 139,300,001 H343Q probably benign Het
Prkdc T C 16: 15,648,976 I107T probably benign Het
Prmt2 A G 10: 76,226,221 I50T probably damaging Het
Ptprd T C 4: 76,140,553 T168A probably benign Het
Pudp A G 18: 50,568,065 V199A probably damaging Het
Rab3c T C 13: 110,061,900 E198G probably benign Het
Rasl12 A G 9: 65,413,448 Y156C probably damaging Het
Rbm12 T C 2: 156,096,564 D596G possibly damaging Het
Rbm6 T C 9: 107,787,352 E694G probably benign Het
Rif1 T C 2: 52,112,747 V2071A probably damaging Het
Ripply2 A T 9: 87,019,796 N125I probably damaging Het
Rps6kc1 A T 1: 190,750,188 H284Q probably benign Het
Scara3 A T 14: 65,953,501 M1K probably null Het
Sfswap A G 5: 129,513,083 T215A probably damaging Het
Shroom2 A C X: 152,660,907 F421V probably benign Het
Sipa1l3 A G 7: 29,377,641 V902A probably damaging Het
Slamf8 G T 1: 172,584,214 P238Q probably damaging Het
Slc44a3 T C 3: 121,527,074 T93A possibly damaging Het
Slc5a7 A T 17: 54,278,700 I363N probably damaging Het
Slc7a2 T A 8: 40,911,058 M436K probably benign Het
Spindoc A G 19: 7,374,091 S223P probably benign Het
Stk11ip T C 1: 75,530,281 F669L possibly damaging Het
Sun3 G A 11: 9,038,266 L19F probably benign Het
Sycp1 C A 3: 102,853,489 A703S possibly damaging Het
Tas2r139 T G 6: 42,141,284 F117V probably damaging Het
Tdrd6 T C 17: 43,625,576 Y1527C probably damaging Het
Tenm4 A C 7: 96,774,046 K683Q probably damaging Het
Tfeb T A 17: 47,788,227 probably null Het
Tmco4 T C 4: 138,998,039 S121P probably damaging Het
Tmprss11d C T 5: 86,306,281 V222M probably damaging Het
Tnks1bp1 T C 2: 85,063,034 W440R probably damaging Het
Trp53bp2 A G 1: 182,448,997 T848A probably benign Het
Tssk1 G A 16: 17,895,062 R237H probably benign Het
Ttll4 A T 1: 74,679,007 T6S possibly damaging Het
Ttn G T 2: 76,721,797 Y29419* probably null Het
Ttn A G 2: 76,769,603 Y19076H probably damaging Het
Ubr3 T A 2: 69,959,603 V867D probably damaging Het
Usp29 A G 7: 6,961,391 T78A probably damaging Het
Utrn T G 10: 12,654,745 Q2108P probably benign Het
Vcan T C 13: 89,705,789 N351D probably damaging Het
Vmn1r61 A T 7: 5,611,125 Y63* probably null Het
Vmn1r61 A T 7: 5,611,127 Y63N probably benign Het
Vmn1r85 A T 7: 13,084,861 W119R probably damaging Het
Zbtb21 A C 16: 97,950,455 V190G possibly damaging Het
Zfp157 C A 5: 138,444,789 T14N probably damaging Het
Zfp942 A T 17: 21,929,419 H76Q probably damaging Het
Other mutations in Fbn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Fbn1 APN 2 125324947 missense probably damaging 1.00
IGL00159:Fbn1 APN 2 125397873 missense probably benign 0.14
IGL00500:Fbn1 APN 2 125317516 missense probably damaging 0.99
IGL00558:Fbn1 APN 2 125329128 splice site probably benign
IGL00645:Fbn1 APN 2 125317103 splice site probably benign
IGL00863:Fbn1 APN 2 125403219 missense possibly damaging 0.84
IGL00926:Fbn1 APN 2 125319042 missense possibly damaging 0.84
IGL00935:Fbn1 APN 2 125377910 nonsense probably null
IGL00950:Fbn1 APN 2 125358823 missense probably damaging 1.00
IGL01090:Fbn1 APN 2 125394776 splice site probably benign
IGL01106:Fbn1 APN 2 125351706 missense possibly damaging 0.55
IGL01486:Fbn1 APN 2 125389978 missense probably benign 0.03
IGL01519:Fbn1 APN 2 125317019 missense probably benign 0.07
IGL01585:Fbn1 APN 2 125360110 missense probably damaging 0.98
IGL01730:Fbn1 APN 2 125312974 splice site probably benign
IGL01793:Fbn1 APN 2 125387293 missense possibly damaging 0.67
IGL01803:Fbn1 APN 2 125350287 missense probably damaging 1.00
IGL01803:Fbn1 APN 2 125301725 missense probably benign
IGL01916:Fbn1 APN 2 125315446 missense possibly damaging 0.55
IGL02035:Fbn1 APN 2 125335362 splice site probably null
IGL02097:Fbn1 APN 2 125363969 missense probably damaging 1.00
IGL02233:Fbn1 APN 2 125321610 splice site probably benign
IGL02512:Fbn1 APN 2 125338460 missense probably damaging 1.00
IGL02552:Fbn1 APN 2 125412713 missense possibly damaging 0.86
IGL02657:Fbn1 APN 2 125352025 missense possibly damaging 0.86
IGL02718:Fbn1 APN 2 125369886 missense probably damaging 1.00
IGL02863:Fbn1 APN 2 125303256 missense possibly damaging 0.80
IGL02974:Fbn1 APN 2 125346330 missense probably null 0.99
IGL03058:Fbn1 APN 2 125403200 missense probably benign 0.03
IGL03172:Fbn1 APN 2 125320968 missense possibly damaging 0.92
IGL03288:Fbn1 APN 2 125303183 missense probably benign 0.13
lincoln UTSW 2 125403170 missense possibly damaging 0.50
reaper UTSW 2 125315404 missense probably damaging 0.98
scythe UTSW 2 125403228 missense possibly damaging 0.84
string_bean UTSW 2 125379134 splice site probably null
wirey UTSW 2 125309495 missense probably benign
3-1:Fbn1 UTSW 2 125394605 splice site probably benign
P0012:Fbn1 UTSW 2 125369321 splice site probably benign
PIT4403001:Fbn1 UTSW 2 125342911 missense probably damaging 1.00
PIT4466001:Fbn1 UTSW 2 125306501 missense possibly damaging 0.90
PIT4472001:Fbn1 UTSW 2 125306501 missense possibly damaging 0.90
PIT4651001:Fbn1 UTSW 2 125363989 critical splice acceptor site probably null
R0226:Fbn1 UTSW 2 125320910 missense possibly damaging 0.86
R0310:Fbn1 UTSW 2 125363644 missense probably damaging 1.00
R0362:Fbn1 UTSW 2 125309777 missense probably damaging 0.99
R0374:Fbn1 UTSW 2 125321676 missense possibly damaging 0.86
R0433:Fbn1 UTSW 2 125348215 missense possibly damaging 0.95
R0441:Fbn1 UTSW 2 125309755 critical splice donor site probably null
R0501:Fbn1 UTSW 2 125301749 missense probably benign 0.23
R0510:Fbn1 UTSW 2 125342925 splice site probably benign
R0573:Fbn1 UTSW 2 125389249 missense probably damaging 0.99
R0622:Fbn1 UTSW 2 125379024 missense possibly damaging 0.88
R0630:Fbn1 UTSW 2 125394770 missense possibly damaging 0.48
R0724:Fbn1 UTSW 2 125352064 missense probably benign 0.14
R0739:Fbn1 UTSW 2 125367630 missense probably benign 0.18
R0744:Fbn1 UTSW 2 125314814 splice site probably benign
R0811:Fbn1 UTSW 2 125403170 missense possibly damaging 0.50
R0812:Fbn1 UTSW 2 125403170 missense possibly damaging 0.50
R0862:Fbn1 UTSW 2 125342891 nonsense probably null
R0864:Fbn1 UTSW 2 125342891 nonsense probably null
R1061:Fbn1 UTSW 2 125345963 missense probably benign 0.01
R1126:Fbn1 UTSW 2 125321192 splice site probably null
R1172:Fbn1 UTSW 2 125394687 missense probably benign 0.13
R1175:Fbn1 UTSW 2 125394687 missense probably benign 0.13
R1183:Fbn1 UTSW 2 125321617 missense probably benign 0.07
R1218:Fbn1 UTSW 2 125412749 missense possibly damaging 0.71
R1241:Fbn1 UTSW 2 125372527 splice site probably benign
R1248:Fbn1 UTSW 2 125301609 missense probably benign 0.01
R1345:Fbn1 UTSW 2 125314671 missense probably damaging 1.00
R1374:Fbn1 UTSW 2 125346434 missense probably damaging 0.99
R1458:Fbn1 UTSW 2 125301929 missense probably benign 0.01
R1474:Fbn1 UTSW 2 125361265 missense possibly damaging 0.72
R1496:Fbn1 UTSW 2 125309495 missense probably benign
R1502:Fbn1 UTSW 2 125363706 nonsense probably null
R1511:Fbn1 UTSW 2 125306285 missense probably benign 0.00
R1588:Fbn1 UTSW 2 125319114 missense probably benign 0.19
R1626:Fbn1 UTSW 2 125341279 missense probably damaging 1.00
R1676:Fbn1 UTSW 2 125309781 missense probably damaging 1.00
R1712:Fbn1 UTSW 2 125346434 missense probably damaging 0.99
R1772:Fbn1 UTSW 2 125403228 missense possibly damaging 0.84
R1776:Fbn1 UTSW 2 125321734 missense possibly damaging 0.71
R1869:Fbn1 UTSW 2 125352027 missense probably benign 0.00
R1894:Fbn1 UTSW 2 125394621 missense probably damaging 0.96
R1925:Fbn1 UTSW 2 125363629 missense probably damaging 1.00
R1957:Fbn1 UTSW 2 125367654 missense possibly damaging 0.93
R1995:Fbn1 UTSW 2 125350373 critical splice acceptor site probably null
R2140:Fbn1 UTSW 2 125343810 missense probably damaging 1.00
R2142:Fbn1 UTSW 2 125412708 missense possibly damaging 0.93
R2268:Fbn1 UTSW 2 125321741 missense possibly damaging 0.49
R3409:Fbn1 UTSW 2 125412665 missense possibly damaging 0.92
R3418:Fbn1 UTSW 2 125320926 missense possibly damaging 0.55
R3508:Fbn1 UTSW 2 125306327 missense probably benign 0.19
R3778:Fbn1 UTSW 2 125317086 missense probably damaging 1.00
R3800:Fbn1 UTSW 2 125345974 missense possibly damaging 0.63
R4001:Fbn1 UTSW 2 125477495 critical splice donor site probably null
R4169:Fbn1 UTSW 2 125363952 missense possibly damaging 0.86
R4398:Fbn1 UTSW 2 125397781 missense probably benign 0.32
R4482:Fbn1 UTSW 2 125363610 critical splice donor site probably null
R4559:Fbn1 UTSW 2 125351714 missense possibly damaging 0.65
R4608:Fbn1 UTSW 2 125306500 missense probably benign 0.05
R4634:Fbn1 UTSW 2 125344061 missense probably damaging 1.00
R4706:Fbn1 UTSW 2 125370149 missense probably benign 0.21
R4712:Fbn1 UTSW 2 125341316 missense probably benign 0.12
R4783:Fbn1 UTSW 2 125324919 missense probably damaging 1.00
R4784:Fbn1 UTSW 2 125324919 missense probably damaging 1.00
R4793:Fbn1 UTSW 2 125321235 nonsense probably null
R4838:Fbn1 UTSW 2 125372399 missense probably benign 0.01
R4864:Fbn1 UTSW 2 125372397 missense possibly damaging 0.92
R4887:Fbn1 UTSW 2 125309774 missense probably damaging 1.00
R4942:Fbn1 UTSW 2 125383616 missense possibly damaging 0.88
R4952:Fbn1 UTSW 2 125317534 missense probably damaging 1.00
R5030:Fbn1 UTSW 2 125412704 missense possibly damaging 0.51
R5044:Fbn1 UTSW 2 125329102 missense probably damaging 0.97
R5057:Fbn1 UTSW 2 125466695 missense probably benign 0.33
R5115:Fbn1 UTSW 2 125332383 missense probably damaging 1.00
R5399:Fbn1 UTSW 2 125332333 missense possibly damaging 0.69
R5498:Fbn1 UTSW 2 125360176 missense probably damaging 1.00
R5526:Fbn1 UTSW 2 125365639 missense possibly damaging 0.83
R5529:Fbn1 UTSW 2 125373950 missense probably benign 0.01
R5602:Fbn1 UTSW 2 125321741 missense possibly damaging 0.49
R5760:Fbn1 UTSW 2 125361247 missense probably damaging 1.00
R5837:Fbn1 UTSW 2 125379134 splice site probably null
R5955:Fbn1 UTSW 2 125358882 missense probably damaging 1.00
R5980:Fbn1 UTSW 2 125315404 missense probably damaging 0.98
R6039:Fbn1 UTSW 2 125363880 missense probably damaging 1.00
R6039:Fbn1 UTSW 2 125363880 missense probably damaging 1.00
R6058:Fbn1 UTSW 2 125466612 missense possibly damaging 0.73
R6089:Fbn1 UTSW 2 125321225 missense possibly damaging 0.55
R6136:Fbn1 UTSW 2 125403132 missense possibly damaging 0.63
R6161:Fbn1 UTSW 2 125369801 nonsense probably null
R6162:Fbn1 UTSW 2 125360227 missense probably damaging 1.00
R6165:Fbn1 UTSW 2 125332363 missense probably damaging 0.99
R6169:Fbn1 UTSW 2 125335489 critical splice acceptor site probably null
R6221:Fbn1 UTSW 2 125320921 missense probably benign 0.07
R6223:Fbn1 UTSW 2 125412671 missense possibly damaging 0.86
R6225:Fbn1 UTSW 2 125330543 missense probably damaging 1.00
R6238:Fbn1 UTSW 2 125324945 missense probably damaging 0.98
R6329:Fbn1 UTSW 2 125308473 missense possibly damaging 0.70
R6401:Fbn1 UTSW 2 125346450 missense probably damaging 0.98
R6480:Fbn1 UTSW 2 125335418 missense probably benign 0.05
R6513:Fbn1 UTSW 2 125383671 missense probably damaging 1.00
R6530:Fbn1 UTSW 2 125389270 missense probably damaging 0.99
R6595:Fbn1 UTSW 2 125342830 missense possibly damaging 0.70
R6781:Fbn1 UTSW 2 125317038 missense probably damaging 1.00
R6849:Fbn1 UTSW 2 125321691 missense possibly damaging 0.82
R6860:Fbn1 UTSW 2 125328158 missense probably damaging 1.00
R6960:Fbn1 UTSW 2 125382060 missense probably benign 0.16
R7134:Fbn1 UTSW 2 125382049 missense probably benign 0.03
X0019:Fbn1 UTSW 2 125383643 missense possibly damaging 0.82
X0020:Fbn1 UTSW 2 125369340 missense probably damaging 1.00
X0028:Fbn1 UTSW 2 125342798 critical splice donor site probably null
X0067:Fbn1 UTSW 2 125369914 missense possibly damaging 0.95
Z1088:Fbn1 UTSW 2 125350288 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AAAGACTCAGAGCTTCGCC -3'
(R):5'- CGTAGGAGGCTCTAAGAGATTCC -3'

Sequencing Primer
(F):5'- CTCAGAGCTTCGCCATGTTTAAAAC -3'
(R):5'- GAGGCTCTAAGAGATTCCATTTTTAC -3'
Posted On2015-12-29