Incidental Mutation 'R4785:Cntnap5a'
ID366898
Institutional Source Beutler Lab
Gene Symbol Cntnap5a
Ensembl Gene ENSMUSG00000070695
Gene Namecontactin associated protein-like 5A
SynonymsCaspr5-1
MMRRC Submission 042417-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.162) question?
Stock #R4785 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location115684756-116587323 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 116101565 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 250 (R250W)
Ref Sequence ENSEMBL: ENSMUSP00000035732 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043725]
Predicted Effect probably benign
Transcript: ENSMUST00000043725
AA Change: R250W

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000035732
Gene: ENSMUSG00000070695
AA Change: R250W

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
FA58C 33 174 1.63e-13 SMART
LamG 201 338 1.4e-26 SMART
LamG 388 522 1.5e-26 SMART
EGF 550 584 2.16e-1 SMART
Blast:FBG 587 772 2e-81 BLAST
LamG 812 939 1.54e-28 SMART
EGF 960 996 2.28e0 SMART
LamG 1037 1173 4.73e-15 SMART
transmembrane domain 1241 1263 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene product belongs to the neurexin family, members of which function in the vertebrate nervous system as cell adhesion molecules and receptors. This protein, like other neurexin proteins, contains epidermal growth factor repeats and laminin G domains. In addition, it includes an F5/8 type C domain, discoidin/neuropilin- and fibrinogen-like domains, and thrombospondin N-terminal-like domains. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 145 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921517D22Rik T C 13: 59,691,592 D13G probably benign Het
4930442H23Rik C T 10: 81,183,144 probably benign Het
5330417C22Rik A T 3: 108,458,227 probably benign Het
Adamts13 T A 2: 26,983,042 S341T probably damaging Het
Adamts2 A G 11: 50,792,722 I944V probably benign Het
Adcy3 A G 12: 4,206,542 T783A probably benign Het
Ago3 A T 4: 126,368,503 M418K probably benign Het
Alpk1 G T 3: 127,687,592 N175K possibly damaging Het
Als2 A G 1: 59,215,313 V295A probably benign Het
Anapc13 T C 9: 102,629,821 I11T probably benign Het
Ankrd12 T A 17: 65,982,999 N1813I probably damaging Het
Anks1b A T 10: 90,914,750 I176F probably null Het
Ap3d1 TTCTCTCTCTCTCTCTCT TTCTCTCTCTCTCTCT 10: 80,712,778 probably null Het
Arhgap32 A G 9: 32,129,653 D67G probably damaging Het
Arhgap32 T C 9: 32,260,780 C1619R probably damaging Het
Atp1a4 A T 1: 172,254,110 Y158* probably null Het
Atp8b5 A T 4: 43,356,980 D576V probably damaging Het
Atrnl1 A G 19: 57,629,158 I122V probably damaging Het
B430203G13Rik A T 12: 17,924,519 noncoding transcript Het
Baz1b T G 5: 135,217,413 L572R possibly damaging Het
Ccnd2 T C 6: 127,148,798 T92A possibly damaging Het
Ccndbp1 A T 2: 121,008,522 T5S probably benign Het
Ccr2 G A 9: 124,106,372 V230I probably benign Het
Cct4 T A 11: 23,002,866 V514E probably damaging Het
Cep152 A G 2: 125,586,329 probably null Het
Cflar C T 1: 58,752,567 T343M probably benign Het
Chrm5 A C 2: 112,479,585 N395K probably benign Het
Chrna10 G A 7: 102,113,219 P255S possibly damaging Het
Chrna6 T A 8: 27,407,106 I248F probably damaging Het
Clip1 T C 5: 123,579,293 D1387G probably damaging Het
Clstn3 T C 6: 124,437,372 probably null Het
Col12a1 C A 9: 79,678,494 V1228F possibly damaging Het
Cxcr5 T C 9: 44,513,341 T340A probably benign Het
Cyp2a4 G A 7: 26,312,875 R361K probably damaging Het
Dnah1 T A 14: 31,263,479 K3818N probably damaging Het
Dnah3 T A 7: 119,967,824 K2393M probably benign Het
Dpy19l1 A T 9: 24,424,823 L529Q probably damaging Het
Eif4g2 C T 7: 111,076,796 R399H probably damaging Het
Fam160a1 G T 3: 85,688,570 T115K probably damaging Het
Fam76a A T 4: 132,902,117 probably null Het
Fam76a A G 4: 132,916,190 Y78H probably damaging Het
Fbn1 A T 2: 125,324,919 C2026S probably damaging Het
Fbxo4 T C 15: 3,969,041 T312A probably benign Het
Fbxw26 A G 9: 109,724,800 V257A possibly damaging Het
Flnb A T 14: 7,905,701 E1150D probably benign Het
Fndc3c1 A T X: 106,437,702 S661R possibly damaging Het
Gba2 A C 4: 43,568,315 L684R probably damaging Het
Gbf1 G T 19: 46,268,395 C812F possibly damaging Het
Glt8d2 A T 10: 82,660,749 D158E probably damaging Het
Golga2 T A 2: 32,297,156 N89K probably damaging Het
Got1 A G 19: 43,502,937 I358T possibly damaging Het
Gpx6 C T 13: 21,312,264 Q3* probably null Het
Grin1 T A 2: 25,292,381 H956L possibly damaging Het
Grin2d A G 7: 45,856,781 V562A probably damaging Het
Grm6 A G 11: 50,857,277 I405V probably benign Het
Hcar2 C G 5: 123,864,450 G330A probably benign Het
Hcfc1 T C X: 73,965,946 K20E probably damaging Het
Iars T A 13: 49,724,663 Y888N probably damaging Het
Ifi206 A T 1: 173,480,866 H521Q probably benign Het
Impg1 A G 9: 80,398,450 S112P probably benign Het
Incenp C A 19: 9,877,690 R619M unknown Het
Incenp T A 19: 9,877,691 R619W unknown Het
Kat2b A G 17: 53,653,203 E513G possibly damaging Het
Kbtbd12 G T 6: 88,618,021 L276I probably damaging Het
Kctd9 T A 14: 67,734,164 D229E probably damaging Het
Kdm1b C T 13: 47,063,077 R308W probably damaging Het
Kif2b G A 11: 91,576,428 P343L probably benign Het
Kntc1 T G 5: 123,816,762 M2081R possibly damaging Het
Lamc1 T C 1: 153,231,740 N1231S probably damaging Het
Lclat1 T A 17: 73,240,070 Y327* probably null Het
Lgals3bp G A 11: 118,393,514 T413I probably damaging Het
Lin54 A G 5: 100,459,738 I250T probably damaging Het
Lrp1 T C 10: 127,558,133 N2621S probably benign Het
Lrrtm3 T A 10: 64,088,002 H462L probably benign Het
Lysmd1 A G 3: 95,134,986 Y57C probably damaging Het
Mccc1 C A 3: 35,975,873 M429I probably damaging Het
Metrnl A G 11: 121,707,924 E40G probably benign Het
Mios T A 6: 8,222,464 M466K probably benign Het
Mrgpra1 A G 7: 47,335,470 S154P probably damaging Het
Mrpl24 T C 3: 87,922,050 probably null Het
Myo1f A G 17: 33,598,191 N736S possibly damaging Het
Myo1h A G 5: 114,360,599 I919V possibly damaging Het
Nampt T C 12: 32,848,714 L443P possibly damaging Het
Ndufaf2 C G 13: 108,052,780 A145P probably damaging Het
Nek10 A T 14: 14,855,714 T403S probably benign Het
Nme8 C A 13: 19,657,930 V219L probably damaging Het
Nov A T 15: 54,752,207 probably null Het
Nps T A 7: 135,268,788 L13Q probably damaging Het
Nutm1 G A 2: 112,248,936 A878V probably benign Het
Ogdh T C 11: 6,349,875 F794L probably damaging Het
Olfr1305 A T 2: 111,873,050 D268E possibly damaging Het
Olfr1441 A T 19: 12,422,977 I223F probably damaging Het
Olfr292 T C 7: 86,694,528 L24P probably damaging Het
Olfr305 C A 7: 86,363,735 G201C probably damaging Het
Olfr721-ps1 A C 14: 14,407,729 Y167S possibly damaging Het
Olfr998 A G 2: 85,590,938 T133A probably benign Het
Pik3cg T C 12: 32,205,199 E263G probably damaging Het
Pikfyve A G 1: 65,267,846 T1798A probably benign Het
Poldip3 T C 15: 83,131,501 Y305C probably damaging Het
Pqlc2 G T 4: 139,300,001 H343Q probably benign Het
Prkdc T C 16: 15,648,976 I107T probably benign Het
Prmt2 A G 10: 76,226,221 I50T probably damaging Het
Ptprd T C 4: 76,140,553 T168A probably benign Het
Pudp A G 18: 50,568,065 V199A probably damaging Het
Rab3c T C 13: 110,061,900 E198G probably benign Het
Rasl12 A G 9: 65,413,448 Y156C probably damaging Het
Rbm12 T C 2: 156,096,564 D596G possibly damaging Het
Rbm6 T C 9: 107,787,352 E694G probably benign Het
Rif1 T C 2: 52,112,747 V2071A probably damaging Het
Ripply2 A T 9: 87,019,796 N125I probably damaging Het
Rps6kc1 A T 1: 190,750,188 H284Q probably benign Het
Scara3 A T 14: 65,953,501 M1K probably null Het
Sfswap A G 5: 129,513,083 T215A probably damaging Het
Shroom2 A C X: 152,660,907 F421V probably benign Het
Sipa1l3 A G 7: 29,377,641 V902A probably damaging Het
Slamf8 G T 1: 172,584,214 P238Q probably damaging Het
Slc44a3 T C 3: 121,527,074 T93A possibly damaging Het
Slc5a7 A T 17: 54,278,700 I363N probably damaging Het
Slc7a2 T A 8: 40,911,058 M436K probably benign Het
Spindoc A G 19: 7,374,091 S223P probably benign Het
Stk11ip T C 1: 75,530,281 F669L possibly damaging Het
Sun3 G A 11: 9,038,266 L19F probably benign Het
Sycp1 C A 3: 102,853,489 A703S possibly damaging Het
Tas2r139 T G 6: 42,141,284 F117V probably damaging Het
Tdrd6 T C 17: 43,625,576 Y1527C probably damaging Het
Tenm4 A C 7: 96,774,046 K683Q probably damaging Het
Tfeb T A 17: 47,788,227 probably null Het
Tmco4 T C 4: 138,998,039 S121P probably damaging Het
Tmprss11d C T 5: 86,306,281 V222M probably damaging Het
Tnks1bp1 T C 2: 85,063,034 W440R probably damaging Het
Trp53bp2 A G 1: 182,448,997 T848A probably benign Het
Tssk1 G A 16: 17,895,062 R237H probably benign Het
Ttll4 A T 1: 74,679,007 T6S possibly damaging Het
Ttn G T 2: 76,721,797 Y29419* probably null Het
Ttn A G 2: 76,769,603 Y19076H probably damaging Het
Ubr3 T A 2: 69,959,603 V867D probably damaging Het
Usp29 A G 7: 6,961,391 T78A probably damaging Het
Utrn T G 10: 12,654,745 Q2108P probably benign Het
Vcan T C 13: 89,705,789 N351D probably damaging Het
Vmn1r61 A T 7: 5,611,125 Y63* probably null Het
Vmn1r61 A T 7: 5,611,127 Y63N probably benign Het
Vmn1r85 A T 7: 13,084,861 W119R probably damaging Het
Zbtb21 A C 16: 97,950,455 V190G possibly damaging Het
Zfp157 C A 5: 138,444,789 T14N probably damaging Het
Zfp942 A T 17: 21,929,419 H76Q probably damaging Het
Other mutations in Cntnap5a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00763:Cntnap5a APN 1 116117677 missense possibly damaging 0.48
IGL00929:Cntnap5a APN 1 116060274 splice site probably null
IGL00959:Cntnap5a APN 1 116184327 missense probably benign 0.00
IGL01721:Cntnap5a APN 1 116157637 missense probably benign
IGL02009:Cntnap5a APN 1 116157494 missense probably benign 0.15
IGL02111:Cntnap5a APN 1 116089352 missense probably benign 0.00
IGL02198:Cntnap5a APN 1 116580532 missense probably benign
IGL02751:Cntnap5a APN 1 116184457 critical splice donor site probably null
IGL02752:Cntnap5a APN 1 116580531 missense probably benign 0.00
IGL02989:Cntnap5a APN 1 116412083 splice site probably benign
IGL03195:Cntnap5a APN 1 116157448 missense probably benign 0.00
PIT4142001:Cntnap5a UTSW 1 115684956 start gained probably benign
R0294:Cntnap5a UTSW 1 115915316 missense probably benign
R0377:Cntnap5a UTSW 1 116292529 missense probably benign 0.04
R0597:Cntnap5a UTSW 1 116184461 splice site probably benign
R0616:Cntnap5a UTSW 1 116580549 missense possibly damaging 0.80
R0725:Cntnap5a UTSW 1 116292476 missense probably benign 0.25
R0842:Cntnap5a UTSW 1 116442223 missense probably damaging 0.96
R1103:Cntnap5a UTSW 1 116580669 missense possibly damaging 0.81
R1265:Cntnap5a UTSW 1 116428518 missense possibly damaging 0.49
R1467:Cntnap5a UTSW 1 115685168 nonsense probably null
R1467:Cntnap5a UTSW 1 115685168 nonsense probably null
R1470:Cntnap5a UTSW 1 116259519 missense probably damaging 1.00
R1470:Cntnap5a UTSW 1 116259519 missense probably damaging 1.00
R1474:Cntnap5a UTSW 1 116442373 nonsense probably null
R1476:Cntnap5a UTSW 1 115901020 missense probably damaging 1.00
R1481:Cntnap5a UTSW 1 116117663 missense probably damaging 1.00
R1512:Cntnap5a UTSW 1 115900950 missense probably benign
R1526:Cntnap5a UTSW 1 116428477 missense probably benign
R1589:Cntnap5a UTSW 1 116060200 missense possibly damaging 0.77
R1603:Cntnap5a UTSW 1 116412101 missense possibly damaging 0.80
R1728:Cntnap5a UTSW 1 116455004 missense probably benign 0.00
R1728:Cntnap5a UTSW 1 116455101 missense probably benign 0.00
R1728:Cntnap5a UTSW 1 116455143 missense probably benign 0.01
R1729:Cntnap5a UTSW 1 116455004 missense probably benign 0.00
R1729:Cntnap5a UTSW 1 116455101 missense probably benign 0.00
R1729:Cntnap5a UTSW 1 116455143 missense probably benign 0.01
R1730:Cntnap5a UTSW 1 116455004 missense probably benign 0.00
R1730:Cntnap5a UTSW 1 116455101 missense probably benign 0.00
R1730:Cntnap5a UTSW 1 116455143 missense probably benign 0.01
R1739:Cntnap5a UTSW 1 116455004 missense probably benign 0.00
R1739:Cntnap5a UTSW 1 116455101 missense probably benign 0.00
R1739:Cntnap5a UTSW 1 116455143 missense probably benign 0.01
R1762:Cntnap5a UTSW 1 116455004 missense probably benign 0.00
R1762:Cntnap5a UTSW 1 116455101 missense probably benign 0.00
R1762:Cntnap5a UTSW 1 116455143 missense probably benign 0.01
R1783:Cntnap5a UTSW 1 116455004 missense probably benign 0.00
R1783:Cntnap5a UTSW 1 116455101 missense probably benign 0.00
R1783:Cntnap5a UTSW 1 116455143 missense probably benign 0.01
R1785:Cntnap5a UTSW 1 116455004 missense probably benign 0.00
R1785:Cntnap5a UTSW 1 116455101 missense probably benign 0.00
R1785:Cntnap5a UTSW 1 116455143 missense probably benign 0.01
R1816:Cntnap5a UTSW 1 116428888 missense probably benign 0.19
R1872:Cntnap5a UTSW 1 116089210 missense probably benign 0.02
R2095:Cntnap5a UTSW 1 116442260 missense probably damaging 1.00
R2113:Cntnap5a UTSW 1 116188365 missense probably damaging 0.98
R2144:Cntnap5a UTSW 1 116101710 missense probably benign 0.14
R2171:Cntnap5a UTSW 1 116188402 missense possibly damaging 0.95
R2219:Cntnap5a UTSW 1 116580639 missense possibly damaging 0.83
R2220:Cntnap5a UTSW 1 116580639 missense possibly damaging 0.83
R2571:Cntnap5a UTSW 1 116184362 missense probably damaging 1.00
R3019:Cntnap5a UTSW 1 116101569 missense probably benign
R3827:Cntnap5a UTSW 1 116117679 missense probably benign 0.14
R3870:Cntnap5a UTSW 1 116060249 missense probably damaging 1.00
R3871:Cntnap5a UTSW 1 116060249 missense probably damaging 1.00
R4041:Cntnap5a UTSW 1 116184399 missense probably benign 0.00
R4080:Cntnap5a UTSW 1 116101574 missense probably benign 0.01
R4260:Cntnap5a UTSW 1 116446595 missense probably benign 0.31
R4685:Cntnap5a UTSW 1 116446680 missense possibly damaging 0.69
R4781:Cntnap5a UTSW 1 116412201 missense possibly damaging 0.88
R5057:Cntnap5a UTSW 1 115685213 missense probably benign 0.10
R5059:Cntnap5a UTSW 1 116428494 missense probably benign 0.44
R5101:Cntnap5a UTSW 1 116442296 missense probably benign 0.00
R5302:Cntnap5a UTSW 1 116157570 missense probably benign 0.15
R5451:Cntnap5a UTSW 1 115685143 missense probably benign
R5473:Cntnap5a UTSW 1 116089256 missense probably benign 0.12
R5886:Cntnap5a UTSW 1 116571672 critical splice donor site probably null
R6311:Cntnap5a UTSW 1 116412106 nonsense probably null
R6464:Cntnap5a UTSW 1 116184408 missense probably benign
R6497:Cntnap5a UTSW 1 116577897 missense probably damaging 1.00
R6781:Cntnap5a UTSW 1 116292397 missense probably benign 0.05
R7137:Cntnap5a UTSW 1 116089376 missense not run
Z1088:Cntnap5a UTSW 1 116060251 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- TGTCAGGAAGTGGAGTCCAG -3'
(R):5'- TGGGAGGACTGACTTACCTC -3'

Sequencing Primer
(F):5'- GAAAGCCTGTGCATGACTTC -3'
(R):5'- GAGGACTGACTTACCTCATAGTC -3'
Posted On2015-12-29