Mutagenetix > Incidental Mutation

Incidental Mutation 'R4785:Tenm4'

366964

Institutional Source

Beutler Lab

Gene Symbol

Tenm4

Ensembl Gene

ENSMUSG00000048078

Gene Name

teneurin transmembrane protein 4

Synonyms

Doc4, l7Rn3, Ten-m4, ELM2, l(7)-3Rn, Odz4

MMRRC Submission

042417-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R4785 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

96171246-96911093 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 96774046 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Lysine to Glutamine at position 683 (K683Q)

Ref Sequence

ENSEMBL: ENSMUSP00000102783 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000107162] [ENSMUST00000107165] [ENSMUST00000107166]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000107162
AA Change: K691Q

PolyPhen 2 Score 0.130 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000102780
Gene: ENSMUSG00000048078
AA Change: K691Q

Domain	Start	End	E-Value	Type
Pfam:Ten_N	10	410	5.6e-195	PFAM
transmembrane domain	411	433	N/A	INTRINSIC
EGF_like	637	665	3.43e1	SMART
EGF	668	696	2.29e1	SMART
EGF	701	730	1.88e-1	SMART
EGF	733	762	1.13e1	SMART
EGF	767	797	2.39e1	SMART
EGF	800	828	4.32e-1	SMART
EGF	831	859	6.02e0	SMART
EGF	862	894	9.93e-1	SMART
low complexity region	900	914	N/A	INTRINSIC
Pfam:RHS_repeat	2327	2380	5.5e-7	PFAM
Pfam:Tox-GHH	2740	2818	5.2e-34	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000107165
AA Change: K683Q

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000102783
Gene: ENSMUSG00000048078
AA Change: K683Q

Domain	Start	End	E-Value	Type
Pfam:Ten_N	36	402	1.1e-171	PFAM
transmembrane domain	403	425	N/A	INTRINSIC
EGF_like	629	657	3.43e1	SMART
EGF	660	688	2.29e1	SMART
EGF	693	722	1.88e-1	SMART
EGF	725	754	1.13e1	SMART
EGF	759	789	2.39e1	SMART
EGF	792	820	4.32e-1	SMART
EGF	823	851	6.02e0	SMART
EGF	863	895	9.93e-1	SMART
low complexity region	901	915	N/A	INTRINSIC
Pfam:RHS_repeat	2335	2368	1.6e-7	PFAM
Pfam:Tox-GHH	2749	2826	1.8e-32	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000107166
AA Change: K646Q

PolyPhen 2 Score 0.246 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000102784
Gene: ENSMUSG00000048078
AA Change: K646Q

Domain	Start	End	E-Value	Type
Pfam:Ten_N	35	193	1.4e-83	PFAM
Pfam:Ten_N	187	365	5e-78	PFAM
transmembrane domain	366	388	N/A	INTRINSIC
EGF_like	592	620	3.43e1	SMART
EGF	623	651	2.29e1	SMART
EGF	656	685	1.88e-1	SMART
EGF	688	717	1.13e1	SMART
EGF	722	752	2.39e1	SMART
EGF	755	783	4.32e-1	SMART
EGF	786	814	6.02e0	SMART
EGF	826	858	9.93e-1	SMART
low complexity region	864	878	N/A	INTRINSIC
Pfam:RHS_repeat	2298	2351	3.8e-7	PFAM
Pfam:Tox-GHH	2711	2789	3.9e-34	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000140140

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.9%
20x: 94.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene plays a role in establishing proper neuronal connectivity during development. Defects in this gene have been associated with hereditary essential tremor-5. [provided by RefSeq, Oct 2016]
PHENOTYPE: Various ENU-induced alleles cause prenatal lethality associated with impaired mesoderm development and lead to pleiotropic phenotypes. The most severe alleles cause failure of gastrulation and somitogenesis while the least severe one allows survival to adulthood with runting of variable penetrance. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 145 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921517D22Rik	T	C	13: 59,691,592	D13G	probably benign	Het
4930442H23Rik	C	T	10: 81,183,144		probably benign	Het
5330417C22Rik	A	T	3: 108,458,227		probably benign	Het
Adamts13	T	A	2: 26,983,042	S341T	probably damaging	Het
Adamts2	A	G	11: 50,792,722	I944V	probably benign	Het
Adcy3	A	G	12: 4,206,542	T783A	probably benign	Het
Ago3	A	T	4: 126,368,503	M418K	probably benign	Het
Alpk1	G	T	3: 127,687,592	N175K	possibly damaging	Het
Als2	A	G	1: 59,215,313	V295A	probably benign	Het
Anapc13	T	C	9: 102,629,821	I11T	probably benign	Het
Ankrd12	T	A	17: 65,982,999	N1813I	probably damaging	Het
Anks1b	A	T	10: 90,914,750	I176F	probably null	Het
Ap3d1	TTCTCTCTCTCTCTCTCT	TTCTCTCTCTCTCTCT	10: 80,712,778		probably null	Het
Arhgap32	A	G	9: 32,129,653	D67G	probably damaging	Het
Arhgap32	T	C	9: 32,260,780	C1619R	probably damaging	Het
Atp1a4	A	T	1: 172,254,110	Y158*	probably null	Het
Atp8b5	A	T	4: 43,356,980	D576V	probably damaging	Het
Atrnl1	A	G	19: 57,629,158	I122V	probably damaging	Het
B430203G13Rik	A	T	12: 17,924,519		noncoding transcript	Het
Baz1b	T	G	5: 135,217,413	L572R	possibly damaging	Het
Ccnd2	T	C	6: 127,148,798	T92A	possibly damaging	Het
Ccndbp1	A	T	2: 121,008,522	T5S	probably benign	Het
Ccr2	G	A	9: 124,106,372	V230I	probably benign	Het
Cct4	T	A	11: 23,002,866	V514E	probably damaging	Het
Cep152	A	G	2: 125,586,329		probably null	Het
Cflar	C	T	1: 58,752,567	T343M	probably benign	Het
Chrm5	A	C	2: 112,479,585	N395K	probably benign	Het
Chrna10	G	A	7: 102,113,219	P255S	possibly damaging	Het
Chrna6	T	A	8: 27,407,106	I248F	probably damaging	Het
Clip1	T	C	5: 123,579,293	D1387G	probably damaging	Het
Clstn3	T	C	6: 124,437,372		probably null	Het
Cntnap5a	C	T	1: 116,101,565	R250W	probably benign	Het
Col12a1	C	A	9: 79,678,494	V1228F	possibly damaging	Het
Cxcr5	T	C	9: 44,513,341	T340A	probably benign	Het
Cyp2a4	G	A	7: 26,312,875	R361K	probably damaging	Het
Dnah1	T	A	14: 31,263,479	K3818N	probably damaging	Het
Dnah3	T	A	7: 119,967,824	K2393M	probably benign	Het
Dpy19l1	A	T	9: 24,424,823	L529Q	probably damaging	Het
Eif4g2	C	T	7: 111,076,796	R399H	probably damaging	Het
Fam160a1	G	T	3: 85,688,570	T115K	probably damaging	Het
Fam76a	A	T	4: 132,902,117		probably null	Het
Fam76a	A	G	4: 132,916,190	Y78H	probably damaging	Het
Fbn1	A	T	2: 125,324,919	C2026S	probably damaging	Het
Fbxo4	T	C	15: 3,969,041	T312A	probably benign	Het
Fbxw26	A	G	9: 109,724,800	V257A	possibly damaging	Het
Flnb	A	T	14: 7,905,701	E1150D	probably benign	Het
Fndc3c1	A	T	X: 106,437,702	S661R	possibly damaging	Het
Gba2	A	C	4: 43,568,315	L684R	probably damaging	Het
Gbf1	G	T	19: 46,268,395	C812F	possibly damaging	Het
Glt8d2	A	T	10: 82,660,749	D158E	probably damaging	Het
Golga2	T	A	2: 32,297,156	N89K	probably damaging	Het
Got1	A	G	19: 43,502,937	I358T	possibly damaging	Het
Gpx6	C	T	13: 21,312,264	Q3*	probably null	Het
Grin1	T	A	2: 25,292,381	H956L	possibly damaging	Het
Grin2d	A	G	7: 45,856,781	V562A	probably damaging	Het
Grm6	A	G	11: 50,857,277	I405V	probably benign	Het
Hcar2	C	G	5: 123,864,450	G330A	probably benign	Het
Hcfc1	T	C	X: 73,965,946	K20E	probably damaging	Het
Iars	T	A	13: 49,724,663	Y888N	probably damaging	Het
Ifi206	A	T	1: 173,480,866	H521Q	probably benign	Het
Impg1	A	G	9: 80,398,450	S112P	probably benign	Het
Incenp	C	A	19: 9,877,690	R619M	unknown	Het
Incenp	T	A	19: 9,877,691	R619W	unknown	Het
Kat2b	A	G	17: 53,653,203	E513G	possibly damaging	Het
Kbtbd12	G	T	6: 88,618,021	L276I	probably damaging	Het
Kctd9	T	A	14: 67,734,164	D229E	probably damaging	Het
Kdm1b	C	T	13: 47,063,077	R308W	probably damaging	Het
Kif2b	G	A	11: 91,576,428	P343L	probably benign	Het
Kntc1	T	G	5: 123,816,762	M2081R	possibly damaging	Het
Lamc1	T	C	1: 153,231,740	N1231S	probably damaging	Het
Lclat1	T	A	17: 73,240,070	Y327*	probably null	Het
Lgals3bp	G	A	11: 118,393,514	T413I	probably damaging	Het
Lin54	A	G	5: 100,459,738	I250T	probably damaging	Het
Lrp1	T	C	10: 127,558,133	N2621S	probably benign	Het
Lrrtm3	T	A	10: 64,088,002	H462L	probably benign	Het
Lysmd1	A	G	3: 95,134,986	Y57C	probably damaging	Het
Mccc1	C	A	3: 35,975,873	M429I	probably damaging	Het
Metrnl	A	G	11: 121,707,924	E40G	probably benign	Het
Mios	T	A	6: 8,222,464	M466K	probably benign	Het
Mrgpra1	A	G	7: 47,335,470	S154P	probably damaging	Het
Mrpl24	T	C	3: 87,922,050		probably null	Het
Myo1f	A	G	17: 33,598,191	N736S	possibly damaging	Het
Myo1h	A	G	5: 114,360,599	I919V	possibly damaging	Het
Nampt	T	C	12: 32,848,714	L443P	possibly damaging	Het
Ndufaf2	C	G	13: 108,052,780	A145P	probably damaging	Het
Nek10	A	T	14: 14,855,714	T403S	probably benign	Het
Nme8	C	A	13: 19,657,930	V219L	probably damaging	Het
Nov	A	T	15: 54,752,207		probably null	Het
Nps	T	A	7: 135,268,788	L13Q	probably damaging	Het
Nutm1	G	A	2: 112,248,936	A878V	probably benign	Het
Ogdh	T	C	11: 6,349,875	F794L	probably damaging	Het
Olfr1305	A	T	2: 111,873,050	D268E	possibly damaging	Het
Olfr1441	A	T	19: 12,422,977	I223F	probably damaging	Het
Olfr292	T	C	7: 86,694,528	L24P	probably damaging	Het
Olfr305	C	A	7: 86,363,735	G201C	probably damaging	Het
Olfr721-ps1	A	C	14: 14,407,729	Y167S	possibly damaging	Het
Olfr998	A	G	2: 85,590,938	T133A	probably benign	Het
Pik3cg	T	C	12: 32,205,199	E263G	probably damaging	Het
Pikfyve	A	G	1: 65,267,846	T1798A	probably benign	Het
Poldip3	T	C	15: 83,131,501	Y305C	probably damaging	Het
Pqlc2	G	T	4: 139,300,001	H343Q	probably benign	Het
Prkdc	T	C	16: 15,648,976	I107T	probably benign	Het
Prmt2	A	G	10: 76,226,221	I50T	probably damaging	Het
Ptprd	T	C	4: 76,140,553	T168A	probably benign	Het
Pudp	A	G	18: 50,568,065	V199A	probably damaging	Het
Rab3c	T	C	13: 110,061,900	E198G	probably benign	Het
Rasl12	A	G	9: 65,413,448	Y156C	probably damaging	Het
Rbm12	T	C	2: 156,096,564	D596G	possibly damaging	Het
Rbm6	T	C	9: 107,787,352	E694G	probably benign	Het
Rif1	T	C	2: 52,112,747	V2071A	probably damaging	Het
Ripply2	A	T	9: 87,019,796	N125I	probably damaging	Het
Rps6kc1	A	T	1: 190,750,188	H284Q	probably benign	Het
Scara3	A	T	14: 65,953,501	M1K	probably null	Het
Sfswap	A	G	5: 129,513,083	T215A	probably damaging	Het
Shroom2	A	C	X: 152,660,907	F421V	probably benign	Het
Sipa1l3	A	G	7: 29,377,641	V902A	probably damaging	Het
Slamf8	G	T	1: 172,584,214	P238Q	probably damaging	Het
Slc44a3	T	C	3: 121,527,074	T93A	possibly damaging	Het
Slc5a7	A	T	17: 54,278,700	I363N	probably damaging	Het
Slc7a2	T	A	8: 40,911,058	M436K	probably benign	Het
Spindoc	A	G	19: 7,374,091	S223P	probably benign	Het
Stk11ip	T	C	1: 75,530,281	F669L	possibly damaging	Het
Sun3	G	A	11: 9,038,266	L19F	probably benign	Het
Sycp1	C	A	3: 102,853,489	A703S	possibly damaging	Het
Tas2r139	T	G	6: 42,141,284	F117V	probably damaging	Het
Tdrd6	T	C	17: 43,625,576	Y1527C	probably damaging	Het
Tfeb	T	A	17: 47,788,227		probably null	Het
Tmco4	T	C	4: 138,998,039	S121P	probably damaging	Het
Tmprss11d	C	T	5: 86,306,281	V222M	probably damaging	Het
Tnks1bp1	T	C	2: 85,063,034	W440R	probably damaging	Het
Trp53bp2	A	G	1: 182,448,997	T848A	probably benign	Het
Tssk1	G	A	16: 17,895,062	R237H	probably benign	Het
Ttll4	A	T	1: 74,679,007	T6S	possibly damaging	Het
Ttn	G	T	2: 76,721,797	Y29419*	probably null	Het
Ttn	A	G	2: 76,769,603	Y19076H	probably damaging	Het
Ubr3	T	A	2: 69,959,603	V867D	probably damaging	Het
Usp29	A	G	7: 6,961,391	T78A	probably damaging	Het
Utrn	T	G	10: 12,654,745	Q2108P	probably benign	Het
Vcan	T	C	13: 89,705,789	N351D	probably damaging	Het
Vmn1r61	A	T	7: 5,611,125	Y63*	probably null	Het
Vmn1r61	A	T	7: 5,611,127	Y63N	probably benign	Het
Vmn1r85	A	T	7: 13,084,861	W119R	probably damaging	Het
Zbtb21	A	C	16: 97,950,455	V190G	possibly damaging	Het
Zfp157	C	A	5: 138,444,789	T14N	probably damaging	Het
Zfp942	A	T	17: 21,929,419	H76Q	probably damaging	Het

Other mutations in Tenm4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00228:Tenm4	APN	7	96868009	missense	probably benign	0.00
IGL00468:Tenm4	APN	7	96874472	missense	probably damaging	0.98
IGL00519:Tenm4	APN	7	96805138	splice site	probably benign
IGL00979:Tenm4	APN	7	96729391	missense	probably damaging	0.96
IGL01401:Tenm4	APN	7	96874267	missense	probably damaging	1.00
IGL01459:Tenm4	APN	7	96729385	missense	probably damaging	1.00
IGL01519:Tenm4	APN	7	96895177	missense	probably damaging	1.00
IGL01545:Tenm4	APN	7	96874303	missense	probably benign	0.00
IGL01579:Tenm4	APN	7	96863502	missense	probably benign	0.00
IGL01587:Tenm4	APN	7	96863502	missense	probably benign	0.00
IGL01625:Tenm4	APN	7	96885358	missense	probably damaging	1.00
IGL01655:Tenm4	APN	7	96553724	missense	probably damaging	1.00
IGL01683:Tenm4	APN	7	96885404	missense	possibly damaging	0.84
IGL01728:Tenm4	APN	7	96896064	missense	probably damaging	1.00
IGL01732:Tenm4	APN	7	96895509	missense	probably damaging	1.00
IGL01924:Tenm4	APN	7	96895212	missense	probably damaging	1.00
IGL01966:Tenm4	APN	7	96553550	missense	probably damaging	1.00
IGL02177:Tenm4	APN	7	96895662	missense	probably benign	0.40
IGL02207:Tenm4	APN	7	96874116	missense	possibly damaging	0.85
IGL02269:Tenm4	APN	7	96823822	missense	probably damaging	1.00
IGL02274:Tenm4	APN	7	96854734	missense	probably damaging	1.00
IGL02375:Tenm4	APN	7	96704137	missense	possibly damaging	0.52
IGL02415:Tenm4	APN	7	96874074	missense	probably damaging	0.98
IGL02472:Tenm4	APN	7	96774176	unclassified	probably benign
IGL02656:Tenm4	APN	7	96885433	missense	probably damaging	1.00
IGL02678:Tenm4	APN	7	96896219	missense	probably damaging	1.00
IGL02829:Tenm4	APN	7	96894998	nonsense	probably null
IGL02863:Tenm4	APN	7	96873706	missense	probably damaging	1.00
IGL03145:Tenm4	APN	7	96842968	missense	probably damaging	0.98
IGL03153:Tenm4	APN	7	96873762	missense	probably damaging	1.00
principium	UTSW	7	96797481	missense	probably damaging	0.98
toccata	UTSW	7	96902989	critical splice donor site	probably null
P0026:Tenm4	UTSW	7	96874527	missense	probably damaging	1.00
R0097:Tenm4	UTSW	7	96892926	missense	probably damaging	1.00
R0097:Tenm4	UTSW	7	96892926	missense	probably damaging	1.00
R0140:Tenm4	UTSW	7	96896052	missense	possibly damaging	0.78
R0164:Tenm4	UTSW	7	96729340	splice site	probably benign
R0277:Tenm4	UTSW	7	96694950	missense	possibly damaging	0.54
R0323:Tenm4	UTSW	7	96694950	missense	possibly damaging	0.54
R0362:Tenm4	UTSW	7	96772035	nonsense	probably null
R0381:Tenm4	UTSW	7	96905881	missense	probably damaging	1.00
R0420:Tenm4	UTSW	7	96873766	missense	possibly damaging	0.85
R0426:Tenm4	UTSW	7	96777851	missense	probably damaging	1.00
R0513:Tenm4	UTSW	7	96895623	missense	probably benign	0.35
R0624:Tenm4	UTSW	7	96774020	missense	probably damaging	1.00
R0837:Tenm4	UTSW	7	96896275	splice site	probably benign
R1037:Tenm4	UTSW	7	96797481	missense	probably damaging	0.98
R1172:Tenm4	UTSW	7	96848044	missense	probably damaging	1.00
R1422:Tenm4	UTSW	7	96550051	missense	probably damaging	0.99
R1427:Tenm4	UTSW	7	96843048	missense	probably benign	0.42
R1462:Tenm4	UTSW	7	96704153	missense	probably damaging	1.00
R1462:Tenm4	UTSW	7	96704153	missense	probably damaging	1.00
R1597:Tenm4	UTSW	7	96902989	critical splice donor site	probably null
R1701:Tenm4	UTSW	7	96902889	missense	probably damaging	1.00
R1707:Tenm4	UTSW	7	96888685	missense	probably damaging	1.00
R1809:Tenm4	UTSW	7	96873780	missense	probably benign	0.17
R1812:Tenm4	UTSW	7	96895940	missense	probably damaging	1.00
R1895:Tenm4	UTSW	7	96735808	missense	probably damaging	1.00
R1933:Tenm4	UTSW	7	96895326	missense	probably damaging	1.00
R1946:Tenm4	UTSW	7	96735808	missense	probably damaging	1.00
R2108:Tenm4	UTSW	7	96906290	missense	probably damaging	1.00
R2151:Tenm4	UTSW	7	96902847	missense	probably damaging	1.00
R2247:Tenm4	UTSW	7	96906009	missense	probably benign	0.03
R2329:Tenm4	UTSW	7	96895862	missense	probably benign	0.00
R2893:Tenm4	UTSW	7	96894990	missense	probably damaging	1.00
R2990:Tenm4	UTSW	7	96893125	splice site	probably null
R3409:Tenm4	UTSW	7	96895160	missense	probably damaging	1.00
R3410:Tenm4	UTSW	7	96852530	missense	probably damaging	0.99
R3411:Tenm4	UTSW	7	96852530	missense	probably damaging	0.99
R3440:Tenm4	UTSW	7	96553516	missense	probably benign	0.00
R3441:Tenm4	UTSW	7	96553516	missense	probably benign	0.00
R3719:Tenm4	UTSW	7	96863563	missense	possibly damaging	0.92
R3772:Tenm4	UTSW	7	96694880	missense	probably damaging	1.00
R3773:Tenm4	UTSW	7	96694880	missense	probably damaging	1.00
R4093:Tenm4	UTSW	7	96895772	missense	probably damaging	1.00
R4439:Tenm4	UTSW	7	96895815	missense	probably benign	0.01
R4441:Tenm4	UTSW	7	96895815	missense	probably benign	0.01
R4510:Tenm4	UTSW	7	96894863	missense	probably benign
R4511:Tenm4	UTSW	7	96894863	missense	probably benign
R4543:Tenm4	UTSW	7	96895815	missense	probably benign	0.01
R4645:Tenm4	UTSW	7	96895742	missense	probably damaging	1.00
R4701:Tenm4	UTSW	7	96895349	missense	probably damaging	1.00
R4707:Tenm4	UTSW	7	96774046	missense	probably damaging	0.99
R4714:Tenm4	UTSW	7	96894924	missense	probably damaging	1.00
R4742:Tenm4	UTSW	7	96797484	missense	probably damaging	0.99
R4784:Tenm4	UTSW	7	96774046	missense	probably damaging	0.99
R4801:Tenm4	UTSW	7	96906245	missense	probably damaging	0.97
R4802:Tenm4	UTSW	7	96906245	missense	probably damaging	0.97
R4880:Tenm4	UTSW	7	96905818	splice site	probably null
R5036:Tenm4	UTSW	7	96694790	missense	probably damaging	1.00
R5036:Tenm4	UTSW	7	96852561	missense	probably damaging	1.00
R5050:Tenm4	UTSW	7	96895788	missense	probably damaging	1.00
R5103:Tenm4	UTSW	7	96842957	missense	probably damaging	1.00
R5106:Tenm4	UTSW	7	96843149	missense	probably damaging	0.99
R5118:Tenm4	UTSW	7	96893086	missense	probably damaging	1.00
R5272:Tenm4	UTSW	7	96874203	missense	probably damaging	0.98
R5282:Tenm4	UTSW	7	96837331	missense	possibly damaging	0.90
R5403:Tenm4	UTSW	7	96888827	missense	probably damaging	1.00
R5404:Tenm4	UTSW	7	96894680	missense	probably damaging	1.00
R5567:Tenm4	UTSW	7	96896209	nonsense	probably null
R5590:Tenm4	UTSW	7	96797400	missense	possibly damaging	0.73
R5590:Tenm4	UTSW	7	96797401	missense	possibly damaging	0.93
R5597:Tenm4	UTSW	7	96553517	missense	probably benign	0.00
R5782:Tenm4	UTSW	7	96893039	missense	probably benign	0.00
R5861:Tenm4	UTSW	7	96843217	intron	probably benign
R5890:Tenm4	UTSW	7	96902860	missense	probably damaging	1.00
R5930:Tenm4	UTSW	7	96854719	missense	probably damaging	1.00
R5940:Tenm4	UTSW	7	96845895	missense	probably damaging	1.00
R6012:Tenm4	UTSW	7	96522433	intron	probably benign
R6060:Tenm4	UTSW	7	96873711	missense	probably damaging	1.00
R6104:Tenm4	UTSW	7	96837289	missense	probably damaging	0.97
R6283:Tenm4	UTSW	7	96874494	missense	probably benign	0.33
R6333:Tenm4	UTSW	7	96774124	missense	probably damaging	1.00
R6522:Tenm4	UTSW	7	96843044	missense	possibly damaging	0.88
R6616:Tenm4	UTSW	7	96553496	missense	probably benign	0.01
R6746:Tenm4	UTSW	7	96892860	missense	probably damaging	1.00
R6751:Tenm4	UTSW	7	96845712	missense	possibly damaging	0.95
R6806:Tenm4	UTSW	7	96811959	missense	possibly damaging	0.95
R6807:Tenm4	UTSW	7	96553496	missense	probably benign	0.01
R6807:Tenm4	UTSW	7	96895271	missense	probably damaging	1.00
R6809:Tenm4	UTSW	7	96553496	missense	probably benign	0.01
R6810:Tenm4	UTSW	7	96553496	missense	probably benign	0.01
R6811:Tenm4	UTSW	7	96553496	missense	probably benign	0.01
R6853:Tenm4	UTSW	7	96837295	missense	possibly damaging	0.94
R6886:Tenm4	UTSW	7	96797392	missense	possibly damaging	0.85
R6920:Tenm4	UTSW	7	96895550	missense	probably damaging	1.00
R6937:Tenm4	UTSW	7	96553496	missense	probably benign	0.01
R6939:Tenm4	UTSW	7	96553496	missense	probably benign	0.01
R7011:Tenm4	UTSW	7	96896135	nonsense	probably null
R7033:Tenm4	UTSW	7	96895223	nonsense	probably null
R7040:Tenm4	UTSW	7	96553496	missense	probably benign	0.01
R7083:Tenm4	UTSW	7	96895349	missense	probably damaging	1.00
R7238:Tenm4	UTSW	7	96553496	missense	probably benign	0.01
R7239:Tenm4	UTSW	7	96553496	missense	probably benign	0.01
R7239:Tenm4	UTSW	7	96735813	missense	possibly damaging	0.47
R7337:Tenm4	UTSW	7	96874126	missense	probably benign	0.44
R7400:Tenm4	UTSW	7	96694803	missense	probably damaging	0.97
R7407:Tenm4	UTSW	7	96773987	missense	possibly damaging	0.89
R7449:Tenm4	UTSW	7	96874213	missense	possibly damaging	0.65
R7473:Tenm4	UTSW	7	96774146	missense	probably damaging	1.00
R7477:Tenm4	UTSW	7	96845808	missense	probably damaging	0.99
R7489:Tenm4	UTSW	7	96837314	missense	possibly damaging	0.90
R7498:Tenm4	UTSW	7	96848017	missense	probably damaging	1.00
R7562:Tenm4	UTSW	7	96888814	missense	probably damaging	1.00
R7615:Tenm4	UTSW	7	96845926	missense	probably damaging	1.00
R7624:Tenm4	UTSW	7	96895985	missense	possibly damaging	0.95
R7626:Tenm4	UTSW	7	96893014	missense	probably damaging	1.00
R7690:Tenm4	UTSW	7	96863533	missense	probably benign	0.00
R7692:Tenm4	UTSW	7	96895403	missense	probably damaging	1.00
R7748:Tenm4	UTSW	7	96894702	missense	probably damaging	1.00
R7763:Tenm4	UTSW	7	96895692	missense	probably benign	0.38
R7792:Tenm4	UTSW	7	96774014	missense	possibly damaging	0.54
R7855:Tenm4	UTSW	7	96873874	missense	probably damaging	1.00
R7868:Tenm4	UTSW	7	96906380	missense	possibly damaging	0.79
R7878:Tenm4	UTSW	7	96852357	missense	probably damaging	1.00
R7997:Tenm4	UTSW	7	96874305	missense	probably benign	0.44
R8017:Tenm4	UTSW	7	96704041	missense	probably damaging	1.00
R8019:Tenm4	UTSW	7	96704041	missense	probably damaging	1.00
R8054:Tenm4	UTSW	7	96729346	splice site	probably benign
R8061:Tenm4	UTSW	7	96852456	missense	probably damaging	1.00
R8108:Tenm4	UTSW	7	96854728	missense	probably benign	0.39
R8140:Tenm4	UTSW	7	96895176	missense	probably damaging	1.00
R8214:Tenm4	UTSW	7	96895407	missense	probably damaging	1.00
R8258:Tenm4	UTSW	7	96867991	missense	probably damaging	1.00
R8259:Tenm4	UTSW	7	96867991	missense	probably damaging	1.00
R8364:Tenm4	UTSW	7	96772106	critical splice donor site	probably null
R8542:Tenm4	UTSW	7	96811932	missense	probably damaging	0.99
R8669:Tenm4	UTSW	7	96905941	missense	probably benign
R8670:Tenm4	UTSW	7	96905941	missense	probably benign
R8683:Tenm4	UTSW	7	96902857	missense	probably damaging	0.99
R8691:Tenm4	UTSW	7	96905941	missense	probably benign
R8692:Tenm4	UTSW	7	96905941	missense	probably benign
R8714:Tenm4	UTSW	7	96905941	missense	probably benign
R8716:Tenm4	UTSW	7	96905941	missense	probably benign
R8735:Tenm4	UTSW	7	96905941	missense	probably benign
R8736:Tenm4	UTSW	7	96905941	missense	probably benign
R8737:Tenm4	UTSW	7	96905941	missense	probably benign
R8738:Tenm4	UTSW	7	96873840	missense	probably damaging	1.00
R8738:Tenm4	UTSW	7	96905941	missense	probably benign
R8739:Tenm4	UTSW	7	96905941	missense	probably benign
R8776:Tenm4	UTSW	7	96895032	missense	probably damaging	1.00
R8776-TAIL:Tenm4	UTSW	7	96895032	missense	probably damaging	1.00
R8777:Tenm4	UTSW	7	96896037	missense	probably damaging	1.00
R8777-TAIL:Tenm4	UTSW	7	96896037	missense	probably damaging	1.00
R8817:Tenm4	UTSW	7	96874128	missense	probably benign	0.01
R8851:Tenm4	UTSW	7	96852503	missense	probably damaging	1.00
R8913:Tenm4	UTSW	7	96702745	splice site	probably benign
R8977:Tenm4	UTSW	7	96811970	missense	probably damaging	1.00
R9100:Tenm4	UTSW	7	96845854	missense	probably damaging	1.00
R9136:Tenm4	UTSW	7	96823918	missense	possibly damaging	0.69
R9163:Tenm4	UTSW	7	96823873	missense	probably damaging	1.00
R9188:Tenm4	UTSW	7	96772027	missense	probably damaging	1.00
R9195:Tenm4	UTSW	7	96892919	missense	probably damaging	1.00
R9217:Tenm4	UTSW	7	96885439	missense	probably damaging	1.00
R9344:Tenm4	UTSW	7	96896145	missense	probably damaging	1.00
R9414:Tenm4	UTSW	7	96896160	missense	probably benign
R9466:Tenm4	UTSW	7	96550045	missense	possibly damaging	0.79
R9559:Tenm4	UTSW	7	96823849	missense	probably benign
R9626:Tenm4	UTSW	7	96896138	missense	probably damaging	1.00
R9673:Tenm4	UTSW	7	96867989	missense	probably damaging	1.00
R9676:Tenm4	UTSW	7	96895431	missense	probably damaging	1.00
R9678:Tenm4	UTSW	7	96737412	missense	possibly damaging	0.94
R9775:Tenm4	UTSW	7	96906554	missense	possibly damaging	0.92
R9790:Tenm4	UTSW	7	96888839	missense	probably damaging	1.00
R9791:Tenm4	UTSW	7	96888839	missense	probably damaging	1.00
R9803:Tenm4	UTSW	7	96553478	missense	probably damaging	1.00
X0021:Tenm4	UTSW	7	96873909	nonsense	probably null
X0026:Tenm4	UTSW	7	96868087	missense	probably damaging	0.98
X0066:Tenm4	UTSW	7	96848030	missense	probably damaging	1.00
X0066:Tenm4	UTSW	7	96894794	missense	probably damaging	1.00
Z1176:Tenm4	UTSW	7	96905914	missense	probably benign	0.00
Z1177:Tenm4	UTSW	7	96863585	missense	probably damaging	0.96

Predicted Primers

PCR Primer
(F):5'- ATGGGTACACAGGGGAGTTC -3'
(R):5'- TCAAAGCAGGAGTCTTTGAAAGC -3'

Sequencing Primer
(F):5'- GTTCACTACCAATCAACCGGTGTG -3'
(R):5'- GCAGGAGTCTTTGAAAGCCATTCC -3'

Posted On

2015-12-29